CU138336 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCGGCGGCGGAACGAAAGAATTGAAGTCGCTAAACATTGCATCATCCGCTTCTCCATAGCAGTAAGATCCCGATGTCTCACACGCAAAGAAAGTCTGAACATCGTCGGGAAACAAACACCGCCGCCGTTCGAGCTGCTCCGATGACGACGGCGTCGAAGGACATTCCGCCGCTGAGTTCATCTCCACCATTTCCTTAAACTTGGAGGATTGGAGTAGGAGGCCGAGAGCTGAGGTGGTGGTGGTGGTGGAGGTGGTCGAG
BLAST of CU138336 vs. TrEMBL
Match: A0A0A0LTX8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G275920 PE=4 SV=1) HSP 1 Score: 158.7 bits (400), Expect = 3.2e-36 Identity = 75/76 (98.68%), Postives = 76/76 (100.00%), Query Frame = -2
BLAST of CU138336 vs. TrEMBL
Match: B9SQW5_RICCO (AP2-type transcription factor OS=Ricinus communis GN=RcWRI2 PE=2 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.7e-16 Identity = 47/74 (63.51%), Postives = 54/74 (72.97%), Query Frame = -2
BLAST of CU138336 vs. TrEMBL
Match: F6HYM6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_11s0037g00870 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 8.2e-16 Identity = 47/75 (62.67%), Postives = 56/75 (74.67%), Query Frame = -2
BLAST of CU138336 vs. TrEMBL
Match: A0A067KRL4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_04085 PE=4 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.1e-15 Identity = 44/74 (59.46%), Postives = 56/74 (75.68%), Query Frame = -2
BLAST of CU138336 vs. TrEMBL
Match: B9HBF5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s19360g PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 6.9e-15 Identity = 43/74 (58.11%), Postives = 54/74 (72.97%), Query Frame = -2
BLAST of CU138336 vs. NCBI nr
Match: gi|778660300|ref|XP_004146716.2| (PREDICTED: AP2-like ethylene-responsive transcription factor At1g16060 [Cucumis sativus]) HSP 1 Score: 157.1 bits (396), Expect = 1.3e-35 Identity = 75/76 (98.68%), Postives = 76/76 (100.00%), Query Frame = -2
BLAST of CU138336 vs. NCBI nr
Match: gi|700210157|gb|KGN65253.1| (hypothetical protein Csa_1G275920 [Cucumis sativus]) HSP 1 Score: 157.1 bits (396), Expect = 1.3e-35 Identity = 75/76 (98.68%), Postives = 76/76 (100.00%), Query Frame = -2
BLAST of CU138336 vs. NCBI nr
Match: gi|659086229|ref|XP_008443823.1| (PREDICTED: AP2-like ethylene-responsive transcription factor At1g16060 [Cucumis melo]) HSP 1 Score: 155.6 bits (392), Expect = 3.9e-35 Identity = 74/76 (97.37%), Postives = 76/76 (100.00%), Query Frame = -2
BLAST of CU138336 vs. NCBI nr
Match: gi|1021311893|ref|NP_001310645.1| (AP2-like ethylene-responsive transcription factor At1g16060 [Ricinus communis]) HSP 1 Score: 90.9 bits (224), Expect = 1.2e-15 Identity = 47/74 (63.51%), Postives = 54/74 (72.97%), Query Frame = -2
BLAST of CU138336 vs. NCBI nr
Match: gi|731407846|ref|XP_010656633.1| (PREDICTED: AP2-like ethylene-responsive transcription factor At1g16060 [Vitis vinifera]) HSP 1 Score: 89.7 bits (221), Expect = 2.6e-15 Identity = 47/75 (62.67%), Postives = 56/75 (74.67%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|