CU137808 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCAGAAAGATAAGGCCTTCTAGTTCTTTCACTCTCCAATTCTTCCTCTTTTTTCTCTCTTAACCCTGGAATTATGTCAACCACTGTTGGGTTTATATCTTTTTTGTCAAATGTGAATCCTAAGTCCTTGAAACCTTGCAGTTCTTCTGATTCTAATTCACTTTGGCTCCTTCTCTTCCTCATTTGGATGAGAAATTGGTGCCACATTTCGTCACTGCTTGTCGGGATTCGACACATTGGGAGGCTGAACTTCTTTTCAAGAAACTCTTGTCTCCC
BLAST of CU137808 vs. TrEMBL
Match: A0A0A0LC64_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G236040 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.4e-26 Identity = 64/91 (70.33%), Postives = 64/91 (70.33%), Query Frame = -1
BLAST of CU137808 vs. NCBI nr
Match: gi|778688583|ref|XP_011652784.1| (PREDICTED: uncharacterized protein LOC101221005 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 9.3e-27 Identity = 64/91 (70.33%), Postives = 64/91 (70.33%), Query Frame = -1
BLAST of CU137808 vs. NCBI nr
Match: gi|700202503|gb|KGN57636.1| (hypothetical protein Csa_3G236040 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 9.3e-27 Identity = 64/91 (70.33%), Postives = 64/91 (70.33%), Query Frame = -1
BLAST of CU137808 vs. NCBI nr
Match: gi|659112411|ref|XP_008456207.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC103496210 [Cucumis melo]) HSP 1 Score: 94.7 bits (234), Expect = 8.7e-17 Identity = 45/62 (72.58%), Postives = 46/62 (74.19%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|