CU137627 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGCATTCAAGAATCGCTCGATTCGATCGAGAAACGTTTTTCGTCAGAGACGGTTGAATCGATCGCCTCTAACGTTCTCGCATTGAGACCGCCATTTTCCGATCTGGAAAAACGCGATTTCGCGTTAATCCACGACGATTACACGGCGATTTCTCATCGACTA
BLAST of CU137627 vs. TrEMBL
Match: A0A0A0K8R1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G056530 PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.0e-20 Identity = 53/54 (98.15%), Postives = 53/54 (98.15%), Query Frame = 2
BLAST of CU137627 vs. NCBI nr
Match: gi|778722006|ref|XP_011658390.1| (PREDICTED: UPF0496 protein At3g49070-like [Cucumis sativus]) HSP 1 Score: 105.5 bits (262), Expect = 2.9e-20 Identity = 53/54 (98.15%), Postives = 53/54 (98.15%), Query Frame = 2
BLAST of CU137627 vs. NCBI nr
Match: gi|659081782|ref|XP_008441510.1| (PREDICTED: UPF0496 protein At3g49070-like [Cucumis melo]) HSP 1 Score: 99.8 bits (247), Expect = 1.6e-18 Identity = 50/54 (92.59%), Postives = 51/54 (94.44%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|