CU137145 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTTATCTGATCTCTGATGCCCAAGCTTTCGATATATCATCGCTTTCAGCTCGGAAGTGTCTATACGAGAAGTGTCTTTCCTGGGAAGCATTTTCAGAGCCGCAATTCCAGCAATGGCTGAATTTGAGACAAAGCCCTCAGGAATCCTCCACCAACAAAACAGATAAAAAAGAATTGAAATGAAATTGCGCCGTCTTGTGAATGAAGAATCGTAAAATTAAGATGATTTTGTGTAAAATTGTTTAATGGGTT
BLAST of CU137145 vs. TrEMBL
Match: A0A0A0KWF9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G000960 PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.1e-24 Identity = 62/83 (74.70%), Postives = 62/83 (74.70%), Query Frame = -3
BLAST of CU137145 vs. NCBI nr
Match: gi|700197619|gb|KGN52777.1| (hypothetical protein Csa_4G000960 [Cucumis sativus]) HSP 1 Score: 119.4 bits (298), Expect = 3.0e-24 Identity = 62/83 (74.70%), Postives = 62/83 (74.70%), Query Frame = -3
BLAST of CU137145 vs. NCBI nr
Match: gi|449469122|ref|XP_004152270.1| (PREDICTED: uncharacterized protein LOC101211126 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 2.5e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -3
BLAST of CU137145 vs. NCBI nr
Match: gi|659108776|ref|XP_008454383.1| (PREDICTED: uncharacterized protein LOC103494799 [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 7.4e-07 Identity = 29/30 (96.67%), Postives = 29/30 (96.67%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|