CU136238 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCTGTGATAGCCTTTTTCGCCATCTCACCCAATTCTTTAGCTTTGTTTCTCATCTCCTCTGCTTCTTTTCCTTCCATAACTCTCCTTATTGCCTTCTCCACAGC
BLAST of CU136238 vs. TrEMBL
Match: A0A0A0K4P5_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_7G073500 PE=3 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 5.0e-09 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -1
BLAST of CU136238 vs. NCBI nr
Match: gi|778725056|ref|XP_011658895.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -1
BLAST of CU136238 vs. NCBI nr
Match: gi|700188681|gb|KGN43914.1| (hypothetical protein Csa_7G073500 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -1
BLAST of CU136238 vs. NCBI nr
Match: gi|659109950|ref|XP_008454967.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis melo]) HSP 1 Score: 59.7 bits (143), Expect = 1.1e-06 Identity = 33/34 (97.06%), Postives = 33/34 (97.06%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|