CU136128 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTAGTAGTCTTGCATCGTTCATTAAACCCCCAATGTGTTGGCGAAGCTTCCTCCTTTCAATCAACCACCGTTGCTCCTGAGCAGCAAAGATGCAAACAACTTTTTCAC
BLAST of CU136128 vs. TrEMBL
Match: A0A0A0LAI2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G239260 PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 4.2e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU136128 vs. TrEMBL
Match: E5GBA4_CUCME (Putative uncharacterized protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 9.4e-11 Identity = 34/35 (97.14%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU136128 vs. TrEMBL
Match: B9I1X1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s02370g PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 4.1e-06 Identity = 26/35 (74.29%), Postives = 30/35 (85.71%), Query Frame = -3
BLAST of CU136128 vs. NCBI nr
Match: gi|778680446|ref|XP_011651318.1| (PREDICTED: myosin heavy chain, striated muscle [Cucumis sativus]) HSP 1 Score: 73.9 bits (180), Expect = 6.1e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU136128 vs. NCBI nr
Match: gi|659133640|ref|XP_008466834.1| (PREDICTED: myosin heavy chain, striated muscle [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 1.4e-10 Identity = 34/35 (97.14%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU136128 vs. NCBI nr
Match: gi|224118294|ref|XP_002317783.1| (hypothetical protein POPTR_0012s02370g [Populus trichocarpa]) HSP 1 Score: 57.4 bits (137), Expect = 5.9e-06 Identity = 26/35 (74.29%), Postives = 30/35 (85.71%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|