CU135879 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTACTTGAACATGGTGATTGAATCGATAGCCGATTGCTGAAGACCAACGGTGTTGATGTACCAAACGTGGTGGTCGATAACGGGTTCTTCTTCATCGTTATCGGGTAGATTCTCAGCTTGAACATCGAACAGAACCGGGAGACGATTATGTCTTGAATTACGATA
BLAST of CU135879 vs. TrEMBL
Match: A0A0A0KK07_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G499220 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 1.8e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -1
BLAST of CU135879 vs. TrEMBL
Match: A0A151S3C2_CAJCA (RING-H2 finger protein ATL1O OS=Cajanus cajan GN=KK1_029031 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.1e-08 Identity = 31/55 (56.36%), Postives = 38/55 (69.09%), Query Frame = -1
BLAST of CU135879 vs. TrEMBL
Match: A0A0B2PG14_GLYSO (E3 ubiquitin-protein ligase RING1 OS=Glycine soja GN=glysoja_010898 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 31/60 (51.67%), Postives = 43/60 (71.67%), Query Frame = -1
BLAST of CU135879 vs. TrEMBL
Match: A0A0R0JX50_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_05G175400 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 31/60 (51.67%), Postives = 43/60 (71.67%), Query Frame = -1
BLAST of CU135879 vs. TrEMBL
Match: I1K4G5_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 31/60 (51.67%), Postives = 43/60 (71.67%), Query Frame = -1
BLAST of CU135879 vs. NCBI nr
Match: gi|449451613|ref|XP_004143556.1| (PREDICTED: E3 ubiquitin-protein ligase RING1-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 2.6e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -1
BLAST of CU135879 vs. NCBI nr
Match: gi|659080025|ref|XP_008440570.1| (PREDICTED: E3 ubiquitin-protein ligase RING1 [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 8.3e-23 Identity = 52/55 (94.55%), Postives = 53/55 (96.36%), Query Frame = -1
BLAST of CU135879 vs. NCBI nr
Match: gi|1012338027|gb|KYP49289.1| (RING-H2 finger protein ATL1O [Cajanus cajan]) HSP 1 Score: 65.1 bits (157), Expect = 4.4e-08 Identity = 31/55 (56.36%), Postives = 38/55 (69.09%), Query Frame = -1
BLAST of CU135879 vs. NCBI nr
Match: gi|1009146148|ref|XP_015890724.1| (PREDICTED: RING-H2 finger protein ATL51-like [Ziziphus jujuba]) HSP 1 Score: 63.2 bits (152), Expect = 1.7e-07 Identity = 30/53 (56.60%), Postives = 39/53 (73.58%), Query Frame = -1
BLAST of CU135879 vs. NCBI nr
Match: gi|1009146154|ref|XP_015890728.1| (PREDICTED: E3 ubiquitin-protein ligase RING1-like [Ziziphus jujuba]) HSP 1 Score: 63.2 bits (152), Expect = 1.7e-07 Identity = 30/53 (56.60%), Postives = 39/53 (73.58%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|