CU135728 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCGTCGCCATCATTCGATGGTAATGATATTGATCATGATGATTGTATTGAGTGGTTGAACTCTAAACCAAATTCTTCCGTGGTTTACATTTCTTTTGGATCTATTTATGTATTGAGTAATACACAAAAGGAGGAAATTTTG
BLAST of CU135728 vs. Swiss-Prot
Match: UGT_FRAAN (Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa GN=GT5 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 2.7e-06 Identity = 24/40 (60.00%), Postives = 28/40 (70.00%), Query Frame = 1
BLAST of CU135728 vs. Swiss-Prot
Match: 5GT2_PERFR (Anthocyanidin 3-O-glucoside 5-O-glucosyltransferase 2 OS=Perilla frutescens GN=PF3R6 PE=2 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 4.6e-06 Identity = 21/36 (58.33%), Postives = 25/36 (69.44%), Query Frame = 1
BLAST of CU135728 vs. TrEMBL
Match: A0A0A0KAS1_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_6G109730 PE=3 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 5.7e-19 Identity = 47/47 (100.00%), Postives = 47/47 (100.00%), Query Frame = 1
BLAST of CU135728 vs. TrEMBL
Match: F6I4F4_VITVI (Glycosyltransferase OS=Vitis vinifera GN=VIT_05s0062g00640 PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.4e-06 Identity = 31/47 (65.96%), Postives = 35/47 (74.47%), Query Frame = 1
BLAST of CU135728 vs. TrEMBL
Match: F6I4E0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0062g00430 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 7.2e-06 Identity = 28/47 (59.57%), Postives = 35/47 (74.47%), Query Frame = 1
BLAST of CU135728 vs. TrEMBL
Match: G7LH45_MEDTR (Glycosyltransferase OS=Medicago truncatula GN=MTR_8g083290 PE=3 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 7.2e-06 Identity = 24/34 (70.59%), Postives = 30/34 (88.24%), Query Frame = 1
BLAST of CU135728 vs. TrEMBL
Match: B9II48_POPTR (Glycosyltransferase OS=Populus trichocarpa GN=POPTR_0016s05290g PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 9.4e-06 Identity = 30/47 (63.83%), Postives = 34/47 (72.34%), Query Frame = 1
BLAST of CU135728 vs. NCBI nr
Match: gi|778712284|ref|XP_011656873.1| (PREDICTED: crocetin glucosyltransferase, chloroplastic-like [Cucumis sativus]) HSP 1 Score: 99.0 bits (245), Expect = 2.4e-18 Identity = 47/47 (100.00%), Postives = 47/47 (100.00%), Query Frame = 1
BLAST of CU135728 vs. NCBI nr
Match: gi|659116574|ref|XP_008458142.1| (PREDICTED: anthocyanidin 3-O-glucoside 5-O-glucosyltransferase-like, partial [Cucumis melo]) HSP 1 Score: 70.9 bits (172), Expect = 6.9e-10 Identity = 34/41 (82.93%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of CU135728 vs. NCBI nr
Match: gi|225433620|ref|XP_002263700.1| (PREDICTED: crocetin glucosyltransferase, chloroplastic-like [Vitis vinifera]) HSP 1 Score: 57.8 bits (138), Expect = 6.0e-06 Identity = 31/47 (65.96%), Postives = 35/47 (74.47%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|