CU134903 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGAGGAAGAAGAAGAAACTTAGGTTAGAATAGAAAAAAGAAAAGTATGGGCGGCTAAGAATCATAAACTGAACCCATCAAATCCACATTGCTTTGAAGTCAATGACTGATTCCTTGGACTTATCACTATTGAGCAATCCGCTGACACCTGTCATTTATCGATCATTTTAAGTTCCTTTGTCGTTGTCAAAACAAGTAACAACAATATGTTTTGGTATACATTGATA
BLAST of CU134903 vs. TrEMBL
Match: A0A0A0L9B0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G209460 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.0e-06 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -2
BLAST of CU134903 vs. NCBI nr
Match: gi|659112197|ref|XP_008456109.1| (PREDICTED: proline-rich receptor-like protein kinase PERK10 [Cucumis melo]) HSP 1 Score: 62.0 bits (149), Expect = 5.1e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -2
BLAST of CU134903 vs. NCBI nr
Match: gi|449446081|ref|XP_004140800.1| (PREDICTED: proline-rich receptor-like protein kinase PERK10 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 5.1e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|