CU134892 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGCTTCTCAAGCAAAGCTAGAGATTTTTTTAATAAAGAAATTGCAGTGTCAAACTCATTCATTGTCTCATACTGCATTGATATCTCTGAATACGCCTCAGCAGCTTCCACAGGAGAAGTTCCTTCTCTCTTGTCGAAAATTCCACTAGCAATCTCCAAACATCTCTTTGCATCAGTAAACTTTTCCTGATTACACAACACTTTTCCCATTGAGAAAAACACAAACCTCCCGAAGTTC
BLAST of CU134892 vs. TrEMBL
Match: A0A0A0K8P3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G375840 PE=4 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 4.7e-26 Identity = 61/61 (100.00%), Postives = 61/61 (100.00%), Query Frame = -2
BLAST of CU134892 vs. TrEMBL
Match: A0A061DP32_THECC (Tetratricopeptide repeat-like superfamily protein OS=Theobroma cacao GN=TCM_004074 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 1.9e-19 Identity = 49/61 (80.33%), Postives = 52/61 (85.25%), Query Frame = -2
BLAST of CU134892 vs. TrEMBL
Match: B9T299_RICCO (Kinesin light chain, putative OS=Ricinus communis GN=RCOM_0463540 PE=4 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 5.6e-19 Identity = 48/61 (78.69%), Postives = 51/61 (83.61%), Query Frame = -2
BLAST of CU134892 vs. TrEMBL
Match: A0A067K416_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17707 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 7.3e-19 Identity = 48/61 (78.69%), Postives = 52/61 (85.25%), Query Frame = -2
BLAST of CU134892 vs. TrEMBL
Match: A0A0D2SJW3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G145300 PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 9.5e-19 Identity = 47/61 (77.05%), Postives = 52/61 (85.25%), Query Frame = -2
BLAST of CU134892 vs. NCBI nr
Match: gi|778727436|ref|XP_004148956.2| (PREDICTED: nephrocystin-3 [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 6.8e-26 Identity = 61/61 (100.00%), Postives = 61/61 (100.00%), Query Frame = -2
BLAST of CU134892 vs. NCBI nr
Match: gi|659100767|ref|XP_008451256.1| (PREDICTED: nephrocystin-3 [Cucumis melo]) HSP 1 Score: 105.5 bits (262), Expect = 4.2e-20 Identity = 52/61 (85.25%), Postives = 54/61 (88.52%), Query Frame = -2
BLAST of CU134892 vs. NCBI nr
Match: gi|590715972|ref|XP_007050323.1| (Tetratricopeptide repeat-like superfamily protein [Theobroma cacao]) HSP 1 Score: 102.8 bits (255), Expect = 2.8e-19 Identity = 49/61 (80.33%), Postives = 52/61 (85.25%), Query Frame = -2
BLAST of CU134892 vs. NCBI nr
Match: gi|645260152|ref|XP_008235697.1| (PREDICTED: nephrocystin-3 [Prunus mume]) HSP 1 Score: 101.7 bits (252), Expect = 6.1e-19 Identity = 48/61 (78.69%), Postives = 53/61 (86.89%), Query Frame = -2
BLAST of CU134892 vs. NCBI nr
Match: gi|255583206|ref|XP_002532368.1| (PREDICTED: uncharacterized protein LOC8277477 [Ricinus communis]) HSP 1 Score: 101.3 bits (251), Expect = 8.0e-19 Identity = 48/61 (78.69%), Postives = 51/61 (83.61%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|