CU134795 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAGCGCTGGTTCGAGTGCAGGCCCGTGTTGTCTTCGTATTCAGCGGATGCGACTCTCTCACGAGGAGTCTGGTAATTCCACACTCAGCGACCCTAGTACCGCCCTTGGATCCCGTTACCTTCAATACTTGTCTGACAGGAAGGAGTTTGCAATGAAGCGTGATAGAAATCTCTCCCAACAGATATGGCGGAGAGGTCGAAGTCCGTCCATGGGCAGTGGAGATGATCTGGAA
BLAST of CU134795 vs. TrEMBL
Match: A0A0A0L5M1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116810 PE=4 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 4.9e-28 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 3
BLAST of CU134795 vs. TrEMBL
Match: W9RNU6_9ROSA (Protein IQ-DOMAIN 14 OS=Morus notabilis GN=L484_023429 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 7.4e-08 Identity = 42/99 (42.42%), Postives = 51/99 (51.52%), Query Frame = 3
BLAST of CU134795 vs. TrEMBL
Match: D7U821_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0048g02680 PE=4 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-07 Identity = 41/99 (41.41%), Postives = 52/99 (52.53%), Query Frame = 3
BLAST of CU134795 vs. TrEMBL
Match: B9GRQ3_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0002s17930g PE=4 SV=2) HSP 1 Score: 59.7 bits (143), Expect = 1.8e-06 Identity = 40/99 (40.40%), Postives = 49/99 (49.49%), Query Frame = 3
BLAST of CU134795 vs. TrEMBL
Match: B9SVG1_RICCO (Calmodulin binding protein, putative OS=Ricinus communis GN=RCOM_0131500 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.1e-06 Identity = 39/99 (39.39%), Postives = 50/99 (50.51%), Query Frame = 3
BLAST of CU134795 vs. NCBI nr
Match: gi|778676613|ref|XP_004134281.2| (PREDICTED: protein IQ-DOMAIN 1 [Cucumis sativus]) HSP 1 Score: 130.2 bits (326), Expect = 1.6e-27 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 3
BLAST of CU134795 vs. NCBI nr
Match: gi|659074749|ref|XP_008437775.1| (PREDICTED: protein IQ-DOMAIN 1 [Cucumis melo]) HSP 1 Score: 127.5 bits (319), Expect = 1.0e-26 Identity = 63/64 (98.44%), Postives = 63/64 (98.44%), Query Frame = 3
BLAST of CU134795 vs. NCBI nr
Match: gi|703114469|ref|XP_010100661.1| (Protein IQ-DOMAIN 14 [Morus notabilis]) HSP 1 Score: 63.2 bits (152), Expect = 2.4e-07 Identity = 42/99 (42.42%), Postives = 51/99 (51.52%), Query Frame = 3
BLAST of CU134795 vs. NCBI nr
Match: gi|225453606|ref|XP_002265121.1| (PREDICTED: protein IQ-DOMAIN 1 [Vitis vinifera]) HSP 1 Score: 62.0 bits (149), Expect = 5.2e-07 Identity = 41/99 (41.41%), Postives = 52/99 (52.53%), Query Frame = 3
BLAST of CU134795 vs. NCBI nr
Match: gi|1009142737|ref|XP_015888885.1| (PREDICTED: protein IQ-DOMAIN 1 [Ziziphus jujuba]) HSP 1 Score: 61.2 bits (147), Expect = 8.9e-07 Identity = 43/100 (43.00%), Postives = 52/100 (52.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|