CU134724 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGTATTGAAAATGTGAAAAATAATACAGGACAGCAATTTTAAGAGATATAAATTGGGTGAGCTTTTGCAGATACCATGATGAAATTTGCTTCTTTTCGGAACAATTGTTGAGATGCTCTACAAGTATGCCATCCCAAGGCCAAAAGAACAGTGTACCAAATCTCTGCAACTTGGAGTAAGCTTTGCCGGGGGTATGTGGCCGGCGTCCTTTGTGCTGTGGTCTCACC
BLAST of CU134724 vs. Swiss-Prot
Match: MPCP3_ARATH (Mitochondrial phosphate carrier protein 3, mitochondrial OS=Arabidopsis thaliana GN=MPT3 PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 2.7e-08 Identity = 26/33 (78.79%), Postives = 27/33 (81.82%), Query Frame = 3
BLAST of CU134724 vs. TrEMBL
Match: A0A0A0LR40_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000680 PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.5e-09 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. TrEMBL
Match: E5GBM3_CUCME (Mitochondrial phosphate transporter OS=Cucumis melo subsp. melo PE=3 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.9e-08 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. TrEMBL
Match: M5WU44_PRUPE (Mitochondrial phosphatic carrier OS=Prunus persica GN=PiC PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 4.2e-08 Identity = 30/33 (90.91%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. TrEMBL
Match: V4VCW0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10031869mg PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 9.4e-08 Identity = 30/33 (90.91%), Postives = 31/33 (93.94%), Query Frame = 3
BLAST of CU134724 vs. TrEMBL
Match: F6GT37_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g00400 PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 9.4e-08 Identity = 30/33 (90.91%), Postives = 31/33 (93.94%), Query Frame = 3
BLAST of CU134724 vs. NCBI nr
Match: gi|449440949|ref|XP_004138246.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like isoform X2 [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 3.2e-09 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. NCBI nr
Match: gi|778655223|ref|XP_011649327.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like isoform X1 [Cucumis sativus]) HSP 1 Score: 69.3 bits (168), Expect = 3.2e-09 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. NCBI nr
Match: gi|659128818|ref|XP_008464385.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like [Cucumis melo]) HSP 1 Score: 67.8 bits (164), Expect = 9.3e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. NCBI nr
Match: gi|645250073|ref|XP_008231038.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial [Prunus mume]) HSP 1 Score: 66.6 bits (161), Expect = 2.1e-08 Identity = 30/33 (90.91%), Postives = 32/33 (96.97%), Query Frame = 3
BLAST of CU134724 vs. NCBI nr
Match: gi|595937067|ref|XP_007215557.1| (hypothetical protein PRUPE_ppa007340mg [Prunus persica]) HSP 1 Score: 66.6 bits (161), Expect = 2.1e-08 Identity = 30/33 (90.91%), Postives = 32/33 (96.97%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|