CU134721 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CACCAAGTTTTCAGCTTCTGTGAAGAGGGTATCATGATCCAAGGAGAAACCAAACCGATTCACTTAGATTTGGTCATTTTGGCTACTGGATATAGAGGGGATTTGAAGTACAGAAATATTTTTTGTCTTCCTCTACTTTCAGG
BLAST of CU134721 vs. TrEMBL
Match: A0A0A0KCW6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G124040 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 2.1e-13 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CU134721 vs. TrEMBL
Match: A0A0A0KE32_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G120420 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 3.7e-10 Identity = 31/38 (81.58%), Postives = 36/38 (94.74%), Query Frame = 1
BLAST of CU134721 vs. TrEMBL
Match: A0A0A0KG35_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G125250 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.2e-08 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 1
BLAST of CU134721 vs. TrEMBL
Match: A0A0A0KEB1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G133660 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 2.6e-08 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 1
BLAST of CU134721 vs. TrEMBL
Match: A0A0L9UC08_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan04g028500 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.3e-07 Identity = 27/44 (61.36%), Postives = 34/44 (77.27%), Query Frame = 1
BLAST of CU134721 vs. NCBI nr
Match: gi|778712724|ref|XP_004140049.2| (PREDICTED: probable flavin-containing monooxygenase 1 [Cucumis sativus]) HSP 1 Score: 84.3 bits (207), Expect = 6.0e-14 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CU134721 vs. NCBI nr
Match: gi|659094719|ref|XP_008448208.1| (PREDICTED: probable flavin-containing monooxygenase 1 [Cucumis melo]) HSP 1 Score: 78.2 bits (191), Expect = 4.3e-12 Identity = 35/38 (92.11%), Postives = 37/38 (97.37%), Query Frame = 1
BLAST of CU134721 vs. NCBI nr
Match: gi|700191468|gb|KGN46672.1| (hypothetical protein Csa_6G120420 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.1e-10 Identity = 31/38 (81.58%), Postives = 36/38 (94.74%), Query Frame = 1
BLAST of CU134721 vs. NCBI nr
Match: gi|778712690|ref|XP_011656921.1| (PREDICTED: probable flavin-containing monooxygenase 1 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.1e-10 Identity = 31/38 (81.58%), Postives = 36/38 (94.74%), Query Frame = 1
BLAST of CU134721 vs. NCBI nr
Match: gi|659094696|ref|XP_008448196.1| (PREDICTED: probable flavin-containing monooxygenase 1 [Cucumis melo]) HSP 1 Score: 72.4 bits (176), Expect = 2.4e-10 Identity = 31/38 (81.58%), Postives = 36/38 (94.74%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|