CU134704 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTAGGGCAGTGGATGAAAGGCCAACTCTCTCGAACTCCTTCTATTGCTTCTTCTGTGGCGACTAAGAGGTCTGATTTGAGGCTTTTGCTTGGTGTTATGGGTGCTCCTCTTGCTCCTGTGCATGTTAGCACCTCCGATCCTCTGCCCCACCTCAGTATAAAAGATACCCCCATTGGAACTTCATCAGCTCAATACAT
BLAST of CU134704 vs. TrEMBL
Match: A0A0A0KT77_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001510 PE=4 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 4.6e-27 Identity = 64/65 (98.46%), Postives = 64/65 (98.46%), Query Frame = 2
BLAST of CU134704 vs. TrEMBL
Match: A0A0V0IL21_SOLCH (Putative soluble secretory phospholipase A2 receptor-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 3.6e-24 Identity = 57/65 (87.69%), Postives = 61/65 (93.85%), Query Frame = 2
BLAST of CU134704 vs. TrEMBL
Match: M1CFP3_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400025854 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.1e-23 Identity = 57/65 (87.69%), Postives = 60/65 (92.31%), Query Frame = 2
BLAST of CU134704 vs. TrEMBL
Match: K4B2V2_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.4e-23 Identity = 56/65 (86.15%), Postives = 61/65 (93.85%), Query Frame = 2
BLAST of CU134704 vs. TrEMBL
Match: B9R732_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1588200 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 5.2e-23 Identity = 55/64 (85.94%), Postives = 60/64 (93.75%), Query Frame = 2
BLAST of CU134704 vs. NCBI nr
Match: gi|449469112|ref|XP_004152265.1| (PREDICTED: uncharacterized protein LOC101209895 [Cucumis sativus]) HSP 1 Score: 127.5 bits (319), Expect = 8.6e-27 Identity = 64/65 (98.46%), Postives = 64/65 (98.46%), Query Frame = 2
BLAST of CU134704 vs. NCBI nr
Match: gi|659108762|ref|XP_008454375.1| (PREDICTED: uncharacterized protein LOC103494793 [Cucumis melo]) HSP 1 Score: 125.9 bits (315), Expect = 2.5e-26 Identity = 63/65 (96.92%), Postives = 64/65 (98.46%), Query Frame = 2
BLAST of CU134704 vs. NCBI nr
Match: gi|698523123|ref|XP_009758366.1| (PREDICTED: uncharacterized protein LOC104211066 [Nicotiana sylvestris]) HSP 1 Score: 119.4 bits (298), Expect = 2.3e-24 Identity = 59/65 (90.77%), Postives = 60/65 (92.31%), Query Frame = 2
BLAST of CU134704 vs. NCBI nr
Match: gi|697101223|ref|XP_009595005.1| (PREDICTED: uncharacterized protein LOC104091382 [Nicotiana tomentosiformis]) HSP 1 Score: 118.6 bits (296), Expect = 4.0e-24 Identity = 58/65 (89.23%), Postives = 60/65 (92.31%), Query Frame = 2
BLAST of CU134704 vs. NCBI nr
Match: gi|565359045|ref|XP_006346333.1| (PREDICTED: uncharacterized protein LOC102594434 [Solanum tuberosum]) HSP 1 Score: 116.3 bits (290), Expect = 2.0e-23 Identity = 57/65 (87.69%), Postives = 60/65 (92.31%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|