CU134191 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCATGCTTCTTCCGCTGTTAATTCGACTCCAATTGCTAATGGTGGTGTTGATTTGGATTCTTCTATCTTTTTGAAAAGAGCCCATGAGTTGAAAGAAGAGGGTAATAAAAGGTTCCAGAATAAGGATTATGTTGGTGCTCTTGAGCAGTATGAAAGTGCACTTCGTCTTACCCCTAAAACTCACCCTGATCGAGCTGTGTTTCATAGTAATAGGGCGGCTTGCTTGATGCAAATGAAGCCAATTGA
BLAST of CU134191 vs. TrEMBL
Match: A0A0A0M0N6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G699630 PE=4 SV=1) HSP 1 Score: 166.0 bits (419), Expect = 1.9e-38 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU134191 vs. TrEMBL
Match: W9QM65_9ROSA (Tetratricopeptide repeat protein 1 OS=Morus notabilis GN=L484_013661 PE=4 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 3.1e-33 Identity = 71/75 (94.67%), Postives = 74/75 (98.67%), Query Frame = 2
BLAST of CU134191 vs. TrEMBL
Match: B9RXE4_RICCO (Heat shock protein 70 (HSP70)-interacting protein, putative OS=Ricinus communis GN=RCOM_0903110 PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 4.5e-32 Identity = 70/80 (87.50%), Postives = 74/80 (92.50%), Query Frame = 2
BLAST of CU134191 vs. TrEMBL
Match: A0A067GSG8_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g004055mg PE=4 SV=1) HSP 1 Score: 143.3 bits (360), Expect = 1.3e-31 Identity = 69/79 (87.34%), Postives = 74/79 (93.67%), Query Frame = 2
BLAST of CU134191 vs. TrEMBL
Match: A0A067JL16_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_21161 PE=4 SV=1) HSP 1 Score: 142.5 bits (358), Expect = 2.2e-31 Identity = 71/77 (92.21%), Postives = 72/77 (93.51%), Query Frame = 2
BLAST of CU134191 vs. NCBI nr
Match: gi|449455373|ref|XP_004145427.1| (PREDICTED: uncharacterized protein LOC101214983 [Cucumis sativus]) HSP 1 Score: 165.6 bits (418), Expect = 3.5e-38 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU134191 vs. NCBI nr
Match: gi|659118187|ref|XP_008458988.1| (PREDICTED: uncharacterized protein LOC103498240 [Cucumis melo]) HSP 1 Score: 165.6 bits (418), Expect = 3.5e-38 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU134191 vs. NCBI nr
Match: gi|703078845|ref|XP_010090999.1| (Tetratricopeptide repeat protein 1 [Morus notabilis]) HSP 1 Score: 148.7 bits (374), Expect = 4.5e-33 Identity = 71/75 (94.67%), Postives = 74/75 (98.67%), Query Frame = 2
BLAST of CU134191 vs. NCBI nr
Match: gi|657984063|ref|XP_008384116.1| (PREDICTED: uncharacterized protein LOC103446761 [Malus domestica]) HSP 1 Score: 144.4 bits (363), Expect = 8.5e-32 Identity = 68/75 (90.67%), Postives = 72/75 (96.00%), Query Frame = 2
BLAST of CU134191 vs. NCBI nr
Match: gi|223542258|gb|EEF43800.1| (heat shock protein 70 (HSP70)-interacting protein, putative [Ricinus communis]) HSP 1 Score: 144.1 bits (362), Expect = 1.1e-31 Identity = 70/80 (87.50%), Postives = 74/80 (92.50%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|