CU133907 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGCGATGGTGTGCTACCTAAAGAGGAGACTCTCAGGCGTGCAGATCTGGAGAAGAAAGCAGTTAATGATATGTTTGTCATACTCTCTGACATTTGGTTGGATAGTGAAGAGGCCATGGGAAAACTGGAGACCATACTTGATGGTTTCGAGAATGTGGAAGTGGTTCCTTCCTTGTTTGTTTTGATGGGGAATTTTTGTTCCCATCCTTGTAATATTG
BLAST of CU133907 vs. Swiss-Prot
Match: DPB2_ARATH (DNA polymerase epsilon subunit B OS=Arabidopsis thaliana GN=DPB2 PE=1 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 5.2e-25 Identity = 53/72 (73.61%), Postives = 58/72 (80.56%), Query Frame = 1
BLAST of CU133907 vs. TrEMBL
Match: A0A0A0LX08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G435200 PE=4 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.1e-33 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CU133907 vs. TrEMBL
Match: A0A061FWB8_THECC (DNA polymerase epsilon subunit B2 isoform 1 OS=Theobroma cacao GN=TCM_013360 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.1e-26 Identity = 59/72 (81.94%), Postives = 66/72 (91.67%), Query Frame = 1
BLAST of CU133907 vs. TrEMBL
Match: A0A061FXF2_THECC (DNA polymerase epsilon subunit B2 isoform 2 (Fragment) OS=Theobroma cacao GN=TCM_013360 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.1e-26 Identity = 59/72 (81.94%), Postives = 66/72 (91.67%), Query Frame = 1
BLAST of CU133907 vs. TrEMBL
Match: A0A067DUC4_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g009713mg PE=4 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 1.9e-26 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CU133907 vs. TrEMBL
Match: A0A067DVL2_CITSI (DNA polymerase epsilon subunit 2 OS=Citrus sinensis GN=CISIN_1g009713mg PE=3 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 1.9e-26 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CU133907 vs. NCBI nr
Match: gi|778660923|ref|XP_011657177.1| (PREDICTED: DNA polymerase epsilon subunit 2 [Cucumis sativus]) HSP 1 Score: 150.2 bits (378), Expect = 1.4e-33 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CU133907 vs. NCBI nr
Match: gi|700210428|gb|KGN65524.1| (hypothetical protein Csa_1G435200 [Cucumis sativus]) HSP 1 Score: 150.2 bits (378), Expect = 1.4e-33 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CU133907 vs. NCBI nr
Match: gi|659066275|ref|XP_008463560.1| (PREDICTED: LOW QUALITY PROTEIN: DNA polymerase epsilon subunit 2 [Cucumis melo]) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/72 (97.22%), Postives = 70/72 (97.22%), Query Frame = 1
BLAST of CU133907 vs. NCBI nr
Match: gi|1012175509|ref|XP_015966828.1| (PREDICTED: DNA polymerase epsilon subunit 2 [Arachis duranensis]) HSP 1 Score: 129.4 bits (324), Expect = 2.5e-27 Identity = 60/72 (83.33%), Postives = 66/72 (91.67%), Query Frame = 1
BLAST of CU133907 vs. NCBI nr
Match: gi|1021519862|ref|XP_016203345.1| (PREDICTED: DNA polymerase epsilon subunit 2 [Arachis ipaensis]) HSP 1 Score: 129.4 bits (324), Expect = 2.5e-27 Identity = 60/72 (83.33%), Postives = 66/72 (91.67%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|