CU133788 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTCCAAAATGGCTTGATGAGCCTATTCTTATGATAAACATTGAATCCTTGAACATCTATATGATGCTTTGCATCCTTCACAAACCCAATGGTCACAACAGCAACCATTTGTATCTTTGTCCAACTGTCCCGGCCCCACTCAGCACCTGGCTGAGGTCTGTAAGTGACCTCTTGAGATATCATCATATCATTCACTA
BLAST of CU133788 vs. Swiss-Prot
Match: MORC4_ARATH (Protein MICRORCHIDIA 4 OS=Arabidopsis thaliana GN=MORC4 PE=3 SV=2) HSP 1 Score: 93.2 bits (230), Expect = 1.1e-18 Identity = 44/65 (67.69%), Postives = 50/65 (76.92%), Query Frame = -3
BLAST of CU133788 vs. Swiss-Prot
Match: MORC7_ARATH (Protein MICRORCHIDIA 7 OS=Arabidopsis thaliana GN=MORC7 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.1e-17 Identity = 43/66 (65.15%), Postives = 50/66 (75.76%), Query Frame = -3
BLAST of CU133788 vs. Swiss-Prot
Match: MORC5_ARATH (Protein MICRORCHIDIA 5 OS=Arabidopsis thaliana GN=MORC5 PE=3 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 5.2e-16 Identity = 39/65 (60.00%), Postives = 45/65 (69.23%), Query Frame = -3
BLAST of CU133788 vs. Swiss-Prot
Match: MORC6_ARATH (Protein MICRORCHIDIA 6 OS=Arabidopsis thaliana GN=MORC6 PE=1 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 4.9e-06 Identity = 28/65 (43.08%), Postives = 39/65 (60.00%), Query Frame = -3
BLAST of CU133788 vs. TrEMBL
Match: A0A0A0LTZ4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G001330 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.0e-22 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. TrEMBL
Match: A0A059A6V7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_K02700 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.2e-21 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. TrEMBL
Match: B9I3W1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s10460g PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 4.9e-21 Identity = 55/67 (82.09%), Postives = 57/67 (85.07%), Query Frame = -3
BLAST of CU133788 vs. TrEMBL
Match: B9IFG1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0015s11300g PE=4 SV=2) HSP 1 Score: 106.3 bits (264), Expect = 1.4e-20 Identity = 53/66 (80.30%), Postives = 57/66 (86.36%), Query Frame = -3
BLAST of CU133788 vs. TrEMBL
Match: M5WAC4_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa025644mg PE=4 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 1.9e-20 Identity = 53/66 (80.30%), Postives = 58/66 (87.88%), Query Frame = -3
BLAST of CU133788 vs. NCBI nr
Match: gi|778655272|ref|XP_011650392.1| (PREDICTED: uncharacterized protein LOC101222073 [Cucumis sativus]) HSP 1 Score: 115.2 bits (287), Expect = 4.4e-23 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. NCBI nr
Match: gi|700208365|gb|KGN63461.1| (hypothetical protein Csa_1G001330 [Cucumis sativus]) HSP 1 Score: 115.2 bits (287), Expect = 4.4e-23 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. NCBI nr
Match: gi|659128850|ref|XP_008464402.1| (PREDICTED: uncharacterized protein LOC103502300 [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 9.8e-23 Identity = 53/65 (81.54%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. NCBI nr
Match: gi|629082650|gb|KCW49095.1| (hypothetical protein EUGRSUZ_K02700 [Eucalyptus grandis]) HSP 1 Score: 111.3 bits (277), Expect = 6.4e-22 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
BLAST of CU133788 vs. NCBI nr
Match: gi|702497009|ref|XP_010037384.1| (PREDICTED: uncharacterized protein LOC104426135 [Eucalyptus grandis]) HSP 1 Score: 111.3 bits (277), Expect = 6.4e-22 Identity = 54/65 (83.08%), Postives = 55/65 (84.62%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|