CU133590 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAAAATGGATTGCTCCAAGTATCCACAGACTTTTGTCGCCAAAATAATCTTGTCTCTGGGCTTTGATTTGTGCCAGTTACCAATGTAAATGTCGGTCCTTCCCTGTGTCTCTTGTTTCATTGGAACTGGATATGCCTCTGCGGTATCTATAA
BLAST of CU133590 vs. Swiss-Prot
Match: TAS_ECOLI (Protein tas OS=Escherichia coli (strain K12) GN=tas PE=1 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 9.9e-07 Identity = 25/44 (56.82%), Postives = 30/44 (68.18%), Query Frame = -3
BLAST of CU133590 vs. Swiss-Prot
Match: TAS_SHIFL (Protein tas OS=Shigella flexneri GN=tas PE=3 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 9.9e-07 Identity = 25/44 (56.82%), Postives = 30/44 (68.18%), Query Frame = -3
BLAST of CU133590 vs. TrEMBL
Match: A0A0A0LPX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031740 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 7.1e-20 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU133590 vs. TrEMBL
Match: A0A161ZJF3_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_024256 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 4.8e-16 Identity = 39/50 (78.00%), Postives = 47/50 (94.00%), Query Frame = -3
BLAST of CU133590 vs. TrEMBL
Match: V7BLE7_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G274000g PE=4 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 3.1e-15 Identity = 38/50 (76.00%), Postives = 47/50 (94.00%), Query Frame = -3
BLAST of CU133590 vs. TrEMBL
Match: A0A0L9TTK7_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan02g007800 PE=4 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 3.1e-15 Identity = 38/50 (76.00%), Postives = 47/50 (94.00%), Query Frame = -3
BLAST of CU133590 vs. TrEMBL
Match: A0A0S3SUU6_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.08G360900 PE=4 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 3.1e-15 Identity = 38/50 (76.00%), Postives = 47/50 (94.00%), Query Frame = -3
BLAST of CU133590 vs. NCBI nr
Match: gi|449439219|ref|XP_004137384.1| (PREDICTED: aldo-keto reductase [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 1.6e-20 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU133590 vs. NCBI nr
Match: gi|700208854|gb|KGN63950.1| (hypothetical protein Csa_1G031740 [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 1.6e-20 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU133590 vs. NCBI nr
Match: gi|659068729|ref|XP_008445879.1| (PREDICTED: homeobox-leucine zipper protein HDG11-like [Cucumis melo]) HSP 1 Score: 101.7 bits (252), Expect = 3.9e-19 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = -3
BLAST of CU133590 vs. NCBI nr
Match: gi|1021029337|gb|KZM87122.1| (hypothetical protein DCAR_024256 [Daucus carota subsp. sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.1e-16 Identity = 39/50 (78.00%), Postives = 47/50 (94.00%), Query Frame = -3
BLAST of CU133590 vs. NCBI nr
Match: gi|743835765|ref|XP_010935909.1| (PREDICTED: aldo-keto reductase-like isoform X1 [Elaeis guineensis]) HSP 1 Score: 93.2 bits (230), Expect = 1.4e-16 Identity = 39/50 (78.00%), Postives = 47/50 (94.00%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|