CU133395 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGAAATGGGAGGATTGTTGACATGAAATCTTCATACGTAAGGGTCGCTGAACCCGTGTAGTTCCTATCCTTCTCCTTGAATTTCTCAGTCAATCCCTTAACTATCATGCCACACTCGACAAAACTGTCAAAATTAAATTCCACTTGTTGGCCACTTCGATCATCGTATAGAGAAATTAGAAGTTGAAGGACTGAGGATGGAACTGCATAGCCAAGACCATAAAGTGCATCCCTCATTTCCAATG
BLAST of CU133395 vs. Swiss-Prot
Match: CML48_ARATH (Probable calcium-binding protein CML48 OS=Arabidopsis thaliana GN=CML48 PE=2 SV=2) HSP 1 Score: 101.7 bits (252), Expect = 3.9e-21 Identity = 46/79 (58.23%), Postives = 60/79 (75.95%), Query Frame = -3
BLAST of CU133395 vs. Swiss-Prot
Match: CML50_ARATH (Probable calcium-binding protein CML50 OS=Arabidopsis thaliana GN=CML50 PE=2 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 8.1e-19 Identity = 44/79 (55.70%), Postives = 54/79 (68.35%), Query Frame = -3
BLAST of CU133395 vs. Swiss-Prot
Match: CML49_ARATH (Probable calcium-binding protein CML49 OS=Arabidopsis thaliana GN=CML49 PE=2 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 3.4e-17 Identity = 41/79 (51.90%), Postives = 53/79 (67.09%), Query Frame = -3
BLAST of CU133395 vs. Swiss-Prot
Match: PEF1_XENLA (Peflin OS=Xenopus laevis GN=pef1 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 4.6e-06 Identity = 26/74 (35.14%), Postives = 41/74 (55.41%), Query Frame = -3
BLAST of CU133395 vs. TrEMBL
Match: A0A0A0LT26_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G164670 PE=4 SV=1) HSP 1 Score: 162.5 bits (410), Expect = 2.1e-37 Identity = 80/80 (100.00%), Postives = 80/80 (100.00%), Query Frame = -3
BLAST of CU133395 vs. TrEMBL
Match: F6HHF9_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0080g00450 PE=4 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 1.8e-28 Identity = 63/80 (78.75%), Postives = 72/80 (90.00%), Query Frame = -3
BLAST of CU133395 vs. TrEMBL
Match: A5AZN0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_043433 PE=4 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 6.7e-28 Identity = 62/80 (77.50%), Postives = 71/80 (88.75%), Query Frame = -3
BLAST of CU133395 vs. TrEMBL
Match: H9ADK2_9CARY (Calcium-dependent protein kinase (Fragment) OS=Haloxylon ammodendron GN=CDPK PE=2 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 2.5e-27 Identity = 59/79 (74.68%), Postives = 69/79 (87.34%), Query Frame = -3
BLAST of CU133395 vs. TrEMBL
Match: H2ER24_9CARY (EFh calcium-binding protein OS=Haloxylon ammodendron PE=2 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 2.5e-27 Identity = 59/79 (74.68%), Postives = 69/79 (87.34%), Query Frame = -3
BLAST of CU133395 vs. NCBI nr
Match: gi|449443448|ref|XP_004139489.1| (PREDICTED: probable calcium-binding protein CML48 [Cucumis sativus]) HSP 1 Score: 164.5 bits (415), Expect = 7.8e-38 Identity = 80/80 (100.00%), Postives = 80/80 (100.00%), Query Frame = -3
BLAST of CU133395 vs. NCBI nr
Match: gi|659071684|ref|XP_008461406.1| (PREDICTED: probable calcium-binding protein CML48 [Cucumis melo]) HSP 1 Score: 164.5 bits (415), Expect = 7.8e-38 Identity = 80/80 (100.00%), Postives = 80/80 (100.00%), Query Frame = -3
BLAST of CU133395 vs. NCBI nr
Match: gi|296084908|emb|CBI28317.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 134.8 bits (338), Expect = 6.6e-29 Identity = 63/80 (78.75%), Postives = 72/80 (90.00%), Query Frame = -3
BLAST of CU133395 vs. NCBI nr
Match: gi|225464942|ref|XP_002275521.1| (PREDICTED: probable calcium-binding protein CML48 [Vitis vinifera]) HSP 1 Score: 134.8 bits (338), Expect = 6.6e-29 Identity = 63/80 (78.75%), Postives = 72/80 (90.00%), Query Frame = -3
BLAST of CU133395 vs. NCBI nr
Match: gi|147846772|emb|CAN80623.1| (hypothetical protein VITISV_043433 [Vitis vinifera]) HSP 1 Score: 132.9 bits (333), Expect = 2.5e-28 Identity = 62/80 (77.50%), Postives = 71/80 (88.75%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|