CU133177 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACGGCCCGGGGGATTTTTGATCAATGCCTGACCGTATTACGAGCGTATGTTGAGCAACAGATGTGAACCTGACATGAACACCTATTCGAATTTGATTACTGGCTTTCTCAAGGCC
BLAST of CU133177 vs. TrEMBL
Match: A0A0A0L3E0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G663730 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 4.0e-07 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 2
BLAST of CU133177 vs. NCBI nr
Match: gi|778697198|ref|XP_011654277.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At5g43820 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 1.2e-07 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 2
BLAST of CU133177 vs. NCBI nr
Match: gi|659104798|ref|XP_008452985.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At5g43820 [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 3.4e-07 Identity = 26/27 (96.30%), Postives = 27/27 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|