CU133128 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGTCCTCATCTCCACTCCAAAACTCATCTGCAAGTTGTTTGAATACTTTTTGAGTGGGATGAAAAGAATCAAAGAACATATGATCTTCAAGATTTTGGCAGTGAGTATAGGGTGAAGAT
BLAST of CU133128 vs. TrEMBL
Match: A0A0A0LQ38_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G296110 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 3.7e-16 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = -2
BLAST of CU133128 vs. NCBI nr
Match: gi|449461429|ref|XP_004148444.1| (PREDICTED: GDSL esterase/lipase 1 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 9.1e-16 Identity = 39/39 (100.00%), Postives = 39/39 (100.00%), Query Frame = -2
BLAST of CU133128 vs. NCBI nr
Match: gi|659116208|ref|XP_008457963.1| (PREDICTED: uncharacterized protein LOC103497528 [Cucumis melo]) HSP 1 Score: 85.1 bits (209), Expect = 2.9e-14 Identity = 37/39 (94.87%), Postives = 37/39 (94.87%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|