CU132700 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGTCACCACTCGGCTTCGCTTGATTAGCAATCAACTAGATAACCATGGAATCCATTCAAGCTTGATCAAAATGAAGGCAATGGCAGCAACTTCGAACCGTCCCCTTCAGATTTCCCCATGGACTTGCTGTTCCTCATTTCCCCGCGAAAT
BLAST of CU132700 vs. NCBI nr
Match: gi|778729487|ref|XP_004141740.2| (PREDICTED: uncharacterized protein LOC101213828 [Cucumis sativus]) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 25/26 (96.15%), Postives = 26/26 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|