CU132643 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATCTAATGGGATCAGTGCAACCCTTTCCAGCAGATTGTTTGTGGCCTTTCCCTCCTCCTTTCTCCAAATACTGCTGATGGTACTCTTCTGCCCTATAGAATCTCTTGGCTGGAAGAATCTCTGTTACAACTTCTTTGTCTTTCAACTCCAACTTCTTGGCTTCTTTGGATTCATGAGCTAAACGAGCTTGTGTCT
BLAST of CU132643 vs. Swiss-Prot
Match: MSRA_SOLLC (Peptide methionine sulfoxide reductase (Fragment) OS=Solanum lycopersicum GN=E4 PE=3 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 4.8e-14 Identity = 35/39 (89.74%), Postives = 34/39 (87.18%), Query Frame = -3
BLAST of CU132643 vs. Swiss-Prot
Match: MSRA_FRAAN (Peptide methionine sulfoxide reductase OS=Fragaria ananassa PE=2 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 1.1e-13 Identity = 34/39 (87.18%), Postives = 34/39 (87.18%), Query Frame = -3
BLAST of CU132643 vs. Swiss-Prot
Match: MSRA4_ORYSJ (Peptide methionine sulfoxide reductase A4, chloroplastic OS=Oryza sativa subsp. japonica GN=MSRA4 PE=2 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 1.7e-11 Identity = 32/39 (82.05%), Postives = 31/39 (79.49%), Query Frame = -3
BLAST of CU132643 vs. Swiss-Prot
Match: MSRA_LACSA (Peptide methionine sulfoxide reductase OS=Lactuca sativa PE=2 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.1e-10 Identity = 30/39 (76.92%), Postives = 30/39 (76.92%), Query Frame = -3
BLAST of CU132643 vs. Swiss-Prot
Match: MSRA1_ARATH (Peptide methionine sulfoxide reductase A1 OS=Arabidopsis thaliana GN=MSRA1 PE=2 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 2.5e-10 Identity = 30/39 (76.92%), Postives = 30/39 (76.92%), Query Frame = -3
BLAST of CU132643 vs. TrEMBL
Match: A0A0A0LRY2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G002810 PE=3 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 7.2e-17 Identity = 46/64 (71.88%), Postives = 46/64 (71.88%), Query Frame = -3
BLAST of CU132643 vs. TrEMBL
Match: H2ESC5_MORAL (Methionine sulfoxide reductase OS=Morus alba var. multicaulis GN=MMSR PE=2 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.3e-13 Identity = 42/64 (65.62%), Postives = 43/64 (67.19%), Query Frame = -3
BLAST of CU132643 vs. TrEMBL
Match: M5WAP8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011809mg PE=3 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 3.7e-13 Identity = 41/63 (65.08%), Postives = 43/63 (68.25%), Query Frame = -3
BLAST of CU132643 vs. TrEMBL
Match: W9RJD5_9ROSA (Peptide methionine sulfoxide reductase OS=Morus notabilis GN=L484_018939 PE=3 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 4.8e-13 Identity = 41/64 (64.06%), Postives = 42/64 (65.62%), Query Frame = -3
BLAST of CU132643 vs. TrEMBL
Match: A0A067K443_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_11372 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 6.3e-13 Identity = 41/64 (64.06%), Postives = 43/64 (67.19%), Query Frame = -3
BLAST of CU132643 vs. NCBI nr
Match: gi|449440600|ref|XP_004138072.1| (PREDICTED: peptide methionine sulfoxide reductase-like [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-16 Identity = 46/64 (71.88%), Postives = 46/64 (71.88%), Query Frame = -3
BLAST of CU132643 vs. NCBI nr
Match: gi|659129012|ref|XP_008464484.1| (PREDICTED: peptide methionine sulfoxide reductase-like [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.1e-15 Identity = 45/64 (70.31%), Postives = 45/64 (70.31%), Query Frame = -3
BLAST of CU132643 vs. NCBI nr
Match: gi|372864100|gb|AEX99755.1| (methionine sulfoxide reductase [Morus alba var. multicaulis]) HSP 1 Score: 82.8 bits (203), Expect = 2.4e-13 Identity = 42/64 (65.62%), Postives = 43/64 (67.19%), Query Frame = -3
BLAST of CU132643 vs. NCBI nr
Match: gi|1009130677|ref|XP_015882430.1| (PREDICTED: peptide methionine sulfoxide reductase-like [Ziziphus jujuba]) HSP 1 Score: 82.0 bits (201), Expect = 4.1e-13 Identity = 41/64 (64.06%), Postives = 44/64 (68.75%), Query Frame = -3
BLAST of CU132643 vs. NCBI nr
Match: gi|694411051|ref|XP_009333900.1| (PREDICTED: peptide methionine sulfoxide reductase-like [Pyrus x bretschneideri]) HSP 1 Score: 81.3 bits (199), Expect = 6.9e-13 Identity = 41/63 (65.08%), Postives = 43/63 (68.25%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|