CU132369 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGGGAAAAAGGAAGTTAATGGAGCTCCTTTCCGGCGTTGGGTGTTGTTAGGTTATTGTATCGGTGCCGGCAGGCTACAGGAAAAGTATTCGGACGGAGGTGAAGATGTTGGTGGAGCAGAGATACTTGGACCGCAGAAGGTACTTCCGCCCTTTTTGCTACCTCTTCCTCTGTTTTACCACCAACCTCTTCAAATTCCGAAGGCGTTCTAAGAGTTGATGTTTGTCCAAGAAAGTGGATTTGCGGGTTGAGAGTTATTGGATTGACGATTGAGGCTT
BLAST of CU132369 vs. TrEMBL
Match: A0A0A0M3D1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G667000 PE=4 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.0e-07 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 2
BLAST of CU132369 vs. TrEMBL
Match: A0A0A0M3D1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G667000 PE=4 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.2e-04 Identity = 24/24 (100.00%), Postives = 24/24 (100.00%), Query Frame = 3
BLAST of CU132369 vs. NCBI nr
Match: gi|700211645|gb|KGN66741.1| (hypothetical protein Csa_1G667000 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 8.4e-07 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|