CU132297 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCAAACACATTATTTATCTTCTTGTATTAGCAACTTTCTCACCAGAATGAGTGTCAATGGCAGATGCCACAACTCCATAGCTCCCTTTACCAACAACTTCTTCAATCTCGTATTGAGTAGCTTCACCATATTCAGTGAAAAATTCCTTTTCAATCATATTCTTTGAATAGTTGAAGTCAATTATAATCACAAACCACGGGAGCACTATTGAACTGTTCTTCAATTTCCATACTTTCCCC
BLAST of CU132297 vs. Swiss-Prot
Match: MPK9_ARATH (Mitogen-activated protein kinase 9 OS=Arabidopsis thaliana GN=MPK9 PE=2 SV=2) HSP 1 Score: 78.6 bits (192), Expect = 3.5e-14 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of CU132297 vs. Swiss-Prot
Match: MPK12_ORYSJ (Mitogen-activated protein kinase 12 OS=Oryza sativa subsp. japonica GN=MPK12 PE=1 SV=2) HSP 1 Score: 77.4 bits (189), Expect = 7.8e-14 Identity = 33/48 (68.75%), Postives = 42/48 (87.50%), Query Frame = -2
BLAST of CU132297 vs. Swiss-Prot
Match: MPK13_ORYSJ (Mitogen-activated protein kinase 13 OS=Oryza sativa subsp. japonica GN=MPK13 PE=2 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.5e-12 Identity = 32/39 (82.05%), Postives = 37/39 (94.87%), Query Frame = -2
BLAST of CU132297 vs. Swiss-Prot
Match: MPK13_ORYSI (Mitogen-activated protein kinase 13 OS=Oryza sativa subsp. indica GN=MPK13 PE=2 SV=2) HSP 1 Score: 73.2 bits (178), Expect = 1.5e-12 Identity = 32/39 (82.05%), Postives = 37/39 (94.87%), Query Frame = -2
BLAST of CU132297 vs. Swiss-Prot
Match: MPK8_ARATH (Mitogen-activated protein kinase 8 OS=Arabidopsis thaliana GN=MPK8 PE=1 SV=2) HSP 1 Score: 72.4 bits (176), Expect = 2.5e-12 Identity = 32/41 (78.05%), Postives = 37/41 (90.24%), Query Frame = -2
BLAST of CU132297 vs. TrEMBL
Match: A0A0A0KMF1_CUCSA (Mitogen-activated protein kinase OS=Cucumis sativus GN=Csa_5G002030 PE=4 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 4.9e-15 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. TrEMBL
Match: M5XB79_PRUPE (Mitogen-activated protein kinase OS=Prunus persica GN=PRUPE_ppa003297mg PE=4 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.4e-14 Identity = 38/52 (73.08%), Postives = 47/52 (90.38%), Query Frame = -2
BLAST of CU132297 vs. TrEMBL
Match: W9QY19_9ROSA (Mitogen-activated protein kinase OS=Morus notabilis GN=L484_015619 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 9.2e-14 Identity = 40/54 (74.07%), Postives = 49/54 (90.74%), Query Frame = -2
BLAST of CU132297 vs. TrEMBL
Match: D7T8T1_VITVI (Mitogen-activated protein kinase OS=Vitis vinifera GN=VIT_01s0011g04920 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.2e-13 Identity = 37/48 (77.08%), Postives = 47/48 (97.92%), Query Frame = -2
BLAST of CU132297 vs. TrEMBL
Match: B9SJ54_RICCO (Mitogen-activated protein kinase OS=Ricinus communis GN=RCOM_0843380 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.6e-13 Identity = 38/43 (88.37%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. NCBI nr
Match: gi|778697922|ref|XP_011654439.1| (PREDICTED: mitogen-activated protein kinase 17-like isoform X2 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. NCBI nr
Match: gi|778697913|ref|XP_011654436.1| (PREDICTED: mitogen-activated protein kinase 9-like isoform X1 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. NCBI nr
Match: gi|659109494|ref|XP_008454747.1| (PREDICTED: mitogen-activated protein kinase 17-like isoform X2 [Cucumis melo]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. NCBI nr
Match: gi|659109484|ref|XP_008454742.1| (PREDICTED: mitogen-activated protein kinase 9-like isoform X1 [Cucumis melo]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
BLAST of CU132297 vs. NCBI nr
Match: gi|596127143|ref|XP_007222000.1| (hypothetical protein PRUPE_ppa003297mg [Prunus persica]) HSP 1 Score: 85.9 bits (211), Expect = 3.5e-14 Identity = 38/52 (73.08%), Postives = 47/52 (90.38%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|