CU132040 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU132040
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	Splicing factor 3a, subunit 3
Location	Chr6 : 5765016 .. 5765964 (+)
Sequence length	112

The following sequences are available for this feature:

GATGATTTTTAGTTTTTGCTACCGAAAATGGAGGTTCTTTGGTTTTGGAAAGGCTAAAGTCCGAACTGCAAGCACGTGGCTTGAAGTGTGGAGGTACTTTACAAGAGAGGGC


Library category	ESTs
fruit (8DPP) library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa6G087750	Csa6G087750	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
FKNP3UI02NYTPW	FKNP3UI02NYTPW	EST