CU132039 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAACTGAACTTCATTTCACGACATGGAAGCAGTGGCGGAGGGATTGTGGAGGCTGGCAGATTACCACGAGAAGCAGGGGGAATTAGGGAAGGCAATAAAGTGTTTGGAAGCCATATGCCAAAGTCCCGTCTCTTTCTTTCCAGTCCTTGAGGTCAAGACTCGGCTTCGAATTGCCACCCTTCTGCTCACTTATTCTCACAACGTCAATCATGCCAAATCCC
BLAST of CU132039 vs. TrEMBL
Match: A0A0A0L4R7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G000010 PE=4 SV=1) HSP 1 Score: 136.0 bits (341), Expect = 1.9e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU132039 vs. TrEMBL
Match: V7BAU7_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G243600g PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.4e-24 Identity = 56/66 (84.85%), Postives = 63/66 (95.45%), Query Frame = 2
BLAST of CU132039 vs. TrEMBL
Match: K7KAE5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_02G238400 PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 3.1e-24 Identity = 55/66 (83.33%), Postives = 62/66 (93.94%), Query Frame = 2
BLAST of CU132039 vs. TrEMBL
Match: A0A0B2S9M1_GLYSO (MAU2 chromatid cohesion factor like OS=Glycine soja GN=glysoja_013351 PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 3.1e-24 Identity = 55/66 (83.33%), Postives = 62/66 (93.94%), Query Frame = 2
BLAST of CU132039 vs. TrEMBL
Match: A0A0B2S4C3_GLYSO (MAU2 chromatid cohesion factor like OS=Glycine soja GN=glysoja_016910 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.1e-24 Identity = 55/66 (83.33%), Postives = 62/66 (93.94%), Query Frame = 2
BLAST of CU132039 vs. NCBI nr
Match: gi|449456905|ref|XP_004146189.1| (PREDICTED: MAU2 chromatid cohesion factor homolog isoform X1 [Cucumis sativus]) HSP 1 Score: 136.7 bits (343), Expect = 1.6e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU132039 vs. NCBI nr
Match: gi|778674503|ref|XP_011650234.1| (PREDICTED: MAU2 chromatid cohesion factor homolog isoform X2 [Cucumis sativus]) HSP 1 Score: 136.7 bits (343), Expect = 1.6e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU132039 vs. NCBI nr
Match: gi|700200444|gb|KGN55577.1| (hypothetical protein Csa_3G000010 [Cucumis sativus]) HSP 1 Score: 136.7 bits (343), Expect = 1.6e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU132039 vs. NCBI nr
Match: gi|659095143|ref|XP_008448423.1| (PREDICTED: LOW QUALITY PROTEIN: MAU2 chromatid cohesion factor homolog [Cucumis melo]) HSP 1 Score: 136.7 bits (343), Expect = 1.6e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU132039 vs. NCBI nr
Match: gi|593499999|ref|XP_007141994.1| (hypothetical protein PHAVU_008G243600g [Phaseolus vulgaris]) HSP 1 Score: 120.6 bits (301), Expect = 1.2e-24 Identity = 56/66 (84.85%), Postives = 63/66 (95.45%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|