CU131955 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGACATCGTTCGCCATTCACCACCCACATCTAACATTGAAAACAGACGTTCTGATTTGAGATTTCAACCCCTCCAATCGCCATTTTCAAGACCTTTAGATCTGATCTATCCTCATCCACCTTCCTTCTTCTTCGAATTCCATCTGCATATTCCCTCTCATTTCCTCAATTCTTTCCTCAGATTCTTCTTCTCAGGTCACCTGTTTCGAAAATCATAAACGTGGCAAGGATGTAATT
BLAST of CU131955 vs. TrEMBL
Match: A0A0A0KJP7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G421750 PE=4 SV=1) HSP 1 Score: 142.9 bits (359), Expect = 1.7e-31 Identity = 66/69 (95.65%), Postives = 67/69 (97.10%), Query Frame = 1
BLAST of CU131955 vs. NCBI nr
Match: gi|700192777|gb|KGN47981.1| (hypothetical protein Csa_6G421750 [Cucumis sativus]) HSP 1 Score: 137.1 bits (344), Expect = 1.4e-29 Identity = 66/69 (95.65%), Postives = 67/69 (97.10%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|