CU131907 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTTGTCTTACACTCGTAATTCTGATGGACTCTGGAGAATTGTTGCACTACCACCACAATACTTAGATAGCTTGAATCTGAGCTGCCTGCCTCAAATGAATCAGTTTACAGCTGGGAGAAAATTGGTGCAGAAAGGCCCTGCTTCCAATGGTACATATTCATTTAATTCACTCAGATGTAGAAGCCTGCTGGAGTCCAATAAAAAGTTACTGGATAGTAAAAGCAATTAAGTC
BLAST of CU131907 vs. TrEMBL
Match: A0A0A0LT77_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043170 PE=4 SV=1) HSP 1 Score: 140.2 bits (352), Expect = 1.1e-30 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 3
BLAST of CU131907 vs. NCBI nr
Match: gi|778657520|ref|XP_004137638.2| (PREDICTED: uncharacterized protein LOC101212209 [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 6.8e-31 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 3
BLAST of CU131907 vs. NCBI nr
Match: gi|659066971|ref|XP_008436999.1| (PREDICTED: uncharacterized protein LOC103482558 [Cucumis melo]) HSP 1 Score: 137.1 bits (344), Expect = 1.3e-29 Identity = 66/71 (92.96%), Postives = 68/71 (95.77%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|