CU131774 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTTTTCCTTGCCTCCTCTTGGCATATTCTGGACAGGCTGCCTACCTTATGAACAATACGGATCATGTGGTTGATGCCTTCTATCGTTCAATCCCAGAATCCATATACTGGCCCGTGTTTGTTGTTGCAACTGCTGCTGCTGTAGTTGCTAGCCAAGCCACTATATCTGCAACATTTTCAATTATCAAGCAGGCTCTTGCTCATGGCTGTTTTCCAAGAGTTTAAAG
BLAST of CU131774 vs. Swiss-Prot
Match: HAK12_ORYSJ (Putative potassium transporter 12 OS=Oryza sativa subsp. japonica GN=HAK12 PE=2 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 5.8e-19 Identity = 45/74 (60.81%), Postives = 50/74 (67.57%), Query Frame = 1
BLAST of CU131774 vs. Swiss-Prot
Match: POT11_ARATH (Potassium transporter 11 OS=Arabidopsis thaliana GN=POT11 PE=2 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.3e-18 Identity = 44/74 (59.46%), Postives = 46/74 (62.16%), Query Frame = 1
BLAST of CU131774 vs. Swiss-Prot
Match: HAK11_ORYSJ (Probable potassium transporter 11 OS=Oryza sativa subsp. japonica GN=HAK11 PE=2 SV=4) HSP 1 Score: 90.9 bits (224), Expect = 6.4e-18 Identity = 44/74 (59.46%), Postives = 48/74 (64.86%), Query Frame = 1
BLAST of CU131774 vs. Swiss-Prot
Match: POT10_ARATH (Potassium transporter 10 OS=Arabidopsis thaliana GN=POT10 PE=2 SV=2) HSP 1 Score: 88.6 bits (218), Expect = 3.2e-17 Identity = 43/74 (58.11%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CU131774 vs. Swiss-Prot
Match: POT9_ARATH (Potassium transporter 9 OS=Arabidopsis thaliana GN=POT9 PE=2 SV=2) HSP 1 Score: 86.3 bits (212), Expect = 1.6e-16 Identity = 40/74 (54.05%), Postives = 46/74 (62.16%), Query Frame = 1
BLAST of CU131774 vs. TrEMBL
Match: K4B5D1_SOLLC (Potassium transporter OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.4e-19 Identity = 52/74 (70.27%), Postives = 52/74 (70.27%), Query Frame = 1
BLAST of CU131774 vs. TrEMBL
Match: A0A061E3N7_THECC (Potassium transporter OS=Theobroma cacao GN=TCM_006029 PE=3 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 3.1e-19 Identity = 50/74 (67.57%), Postives = 52/74 (70.27%), Query Frame = 1
BLAST of CU131774 vs. TrEMBL
Match: M1BIK3_SOLTU (Potassium transporter OS=Solanum tuberosum GN=PGSC0003DMG400017862 PE=3 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.1e-19 Identity = 51/74 (68.92%), Postives = 51/74 (68.92%), Query Frame = 1
BLAST of CU131774 vs. TrEMBL
Match: M1BIK1_SOLTU (Potassium transporter OS=Solanum tuberosum GN=PGSC0003DMG400017862 PE=3 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.1e-19 Identity = 51/74 (68.92%), Postives = 51/74 (68.92%), Query Frame = 1
BLAST of CU131774 vs. TrEMBL
Match: M1BIK2_SOLTU (Potassium transporter OS=Solanum tuberosum GN=PGSC0003DMG400017862 PE=3 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.1e-19 Identity = 51/74 (68.92%), Postives = 51/74 (68.92%), Query Frame = 1
BLAST of CU131774 vs. NCBI nr
Match: gi|778658295|ref|XP_011652452.1| (PREDICTED: potassium transporter 10-like [Cucumis sativus]) HSP 1 Score: 112.1 bits (279), Expect = 4.3e-22 Identity = 54/74 (72.97%), Postives = 54/74 (72.97%), Query Frame = 1
BLAST of CU131774 vs. NCBI nr
Match: gi|659067648|ref|XP_008440560.1| (PREDICTED: potassium transporter 11-like [Cucumis melo]) HSP 1 Score: 112.1 bits (279), Expect = 4.3e-22 Identity = 54/74 (72.97%), Postives = 54/74 (72.97%), Query Frame = 1
BLAST of CU131774 vs. NCBI nr
Match: gi|970010006|ref|XP_015065902.1| (PREDICTED: potassium transporter 11 [Solanum pennellii]) HSP 1 Score: 105.5 bits (262), Expect = 4.0e-20 Identity = 52/74 (70.27%), Postives = 52/74 (70.27%), Query Frame = 1
BLAST of CU131774 vs. NCBI nr
Match: gi|460371520|ref|XP_004231584.1| (PREDICTED: potassium transporter 11-like [Solanum lycopersicum]) HSP 1 Score: 105.5 bits (262), Expect = 4.0e-20 Identity = 52/74 (70.27%), Postives = 52/74 (70.27%), Query Frame = 1
BLAST of CU131774 vs. NCBI nr
Match: gi|590681263|ref|XP_007041056.1| (K+ uptake permease 11 isoform 1 [Theobroma cacao]) HSP 1 Score: 104.4 bits (259), Expect = 9.0e-20 Identity = 50/74 (67.57%), Postives = 52/74 (70.27%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|