CU131068 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAAGTCAACTTGAAACTGCTTTGGCTGTTCTTCAATTCATTAGCTTAGAATTTTGTAAAAAAGATGGATTCCTTTGCTGCAAACTCAAAGAAATCATTCCACATTCGTTCAAACAGTTTGCCCTCAAAGCCACATCCAGTTGTGGATGAAGTTAATGAAAATCTTTGCAGATTGAGAGCATCTGAAGAAGCCACTTCTTCATCTTCTTCTTTGTGCCAAAAACTTGATGGACTTCAAG
BLAST of CU131068 vs. TrEMBL
Match: A0A0A0K1H9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G023920 PE=4 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 8.5e-15 Identity = 41/58 (70.69%), Postives = 46/58 (79.31%), Query Frame = 3
BLAST of CU131068 vs. TrEMBL
Match: A0A0A0K2R6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G021920 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.6e-13 Identity = 42/58 (72.41%), Postives = 45/58 (77.59%), Query Frame = 3
BLAST of CU131068 vs. TrEMBL
Match: A0A0A0K2S2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G023930 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.8e-09 Identity = 33/58 (56.90%), Postives = 43/58 (74.14%), Query Frame = 3
BLAST of CU131068 vs. TrEMBL
Match: A0A0A0K4V7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G023960 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.0e-09 Identity = 34/59 (57.63%), Postives = 41/59 (69.49%), Query Frame = 3
BLAST of CU131068 vs. TrEMBL
Match: A0A0A0K0T5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G023940 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.0e-08 Identity = 34/58 (58.62%), Postives = 39/58 (67.24%), Query Frame = 3
BLAST of CU131068 vs. NCBI nr
Match: gi|659094088|ref|XP_008447876.1| (PREDICTED: uncharacterized protein LOC103490230 [Cucumis melo]) HSP 1 Score: 95.1 bits (235), Expect = 5.9e-17 Identity = 46/58 (79.31%), Postives = 47/58 (81.03%), Query Frame = 3
BLAST of CU131068 vs. NCBI nr
Match: gi|659094086|ref|XP_008447875.1| (PREDICTED: uncharacterized protein LOC103490229 [Cucumis melo]) HSP 1 Score: 89.7 bits (221), Expect = 2.5e-15 Identity = 43/58 (74.14%), Postives = 46/58 (79.31%), Query Frame = 3
BLAST of CU131068 vs. NCBI nr
Match: gi|659094523|ref|XP_008448107.1| (PREDICTED: uncharacterized protein LOC103490394 [Cucumis melo]) HSP 1 Score: 89.4 bits (220), Expect = 3.2e-15 Identity = 44/58 (75.86%), Postives = 46/58 (79.31%), Query Frame = 3
BLAST of CU131068 vs. NCBI nr
Match: gi|778723198|ref|XP_004144940.2| (PREDICTED: uncharacterized protein LOC101211103 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 41/58 (70.69%), Postives = 46/58 (79.31%), Query Frame = 3
BLAST of CU131068 vs. NCBI nr
Match: gi|659094080|ref|XP_008447872.1| (PREDICTED: uncharacterized protein LOC103490225 [Cucumis melo]) HSP 1 Score: 83.2 bits (204), Expect = 2.3e-13 Identity = 43/58 (74.14%), Postives = 45/58 (77.59%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|