CU130250 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTATTTTCCACAGTTAATCCACTAGTATCTCTCTGTAGAATCGTCACCTGCGCAGACAGAGTGGTAGCTTCGGACTGCAGAGTCTGAACCTTTCTCTCCAGTTCATTCGTGTATCGTATCTTCCTCTCTTTCGAACGAGCCGCAGATTGTCTGTTCGCAAGAATCCTTTTAGCTCTTTTCGGGTCAATTAGGGCAAGCTCCGCAAGTCTCTCCGGGTCCATCGCCTTCTTCACTCCAT
BLAST of CU130250 vs. Swiss-Prot
Match: RF2B_ORYSJ (Transcription factor RF2b OS=Oryza sativa subsp. japonica GN=RF2b PE=1 SV=2) HSP 1 Score: 121.7 bits (304), Expect = 3.6e-27 Identity = 62/76 (81.58%), Postives = 67/76 (88.16%), Query Frame = -3
BLAST of CU130250 vs. Swiss-Prot
Match: POF21_ARATH (Probable transcription factor PosF21 OS=Arabidopsis thaliana GN=POSF21 PE=2 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.0e-26 Identity = 63/76 (82.89%), Postives = 67/76 (88.16%), Query Frame = -3
BLAST of CU130250 vs. Swiss-Prot
Match: VIP1_ARATH (Transcription factor VIP1 OS=Arabidopsis thaliana GN=VIP1 PE=1 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.3e-26 Identity = 63/74 (85.14%), Postives = 65/74 (87.84%), Query Frame = -3
BLAST of CU130250 vs. Swiss-Prot
Match: RF2A_ORYSJ (Transcription factor RF2a OS=Oryza sativa subsp. japonica GN=RF2a PE=1 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.0e-26 Identity = 61/76 (80.26%), Postives = 66/76 (86.84%), Query Frame = -3
BLAST of CU130250 vs. Swiss-Prot
Match: BZP02_ORYSJ (Basic leucine zipper 2 OS=Oryza sativa subsp. japonica GN=BZIP02 PE=2 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.3e-12 Identity = 38/71 (53.52%), Postives = 47/71 (66.20%), Query Frame = -3
BLAST of CU130250 vs. TrEMBL
Match: A0A0A0K9Q8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G324150 PE=4 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 1.0e-33 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -3
BLAST of CU130250 vs. TrEMBL
Match: A0A0J8D151_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_1g011350 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 6.4e-31 Identity = 73/79 (92.41%), Postives = 77/79 (97.47%), Query Frame = -3
BLAST of CU130250 vs. TrEMBL
Match: A0A0K9QGQ4_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_181430 PE=4 SV=1) HSP 1 Score: 140.2 bits (352), Expect = 1.1e-30 Identity = 71/79 (89.87%), Postives = 77/79 (97.47%), Query Frame = -3
BLAST of CU130250 vs. TrEMBL
Match: F6GYV2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_18s0076g00330 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.4e-30 Identity = 72/79 (91.14%), Postives = 76/79 (96.20%), Query Frame = -3
BLAST of CU130250 vs. TrEMBL
Match: A0A067L3F8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_25192 PE=4 SV=1) HSP 1 Score: 139.4 bits (350), Expect = 1.8e-30 Identity = 72/79 (91.14%), Postives = 77/79 (97.47%), Query Frame = -3
BLAST of CU130250 vs. NCBI nr
Match: gi|449443774|ref|XP_004139652.1| (PREDICTED: transcription factor VIP1-like [Cucumis sativus]) HSP 1 Score: 142.1 bits (357), Expect = 4.1e-31 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -3
BLAST of CU130250 vs. NCBI nr
Match: gi|659123141|ref|XP_008461512.1| (PREDICTED: transcription factor VIP1 [Cucumis melo]) HSP 1 Score: 142.1 bits (357), Expect = 4.1e-31 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = -3
BLAST of CU130250 vs. NCBI nr
Match: gi|731313494|ref|XP_010680531.1| (PREDICTED: transcription factor VIP1 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 132.9 bits (333), Expect = 2.5e-28 Identity = 73/79 (92.41%), Postives = 77/79 (97.47%), Query Frame = -3
BLAST of CU130250 vs. NCBI nr
Match: gi|902160153|gb|KNA06400.1| (hypothetical protein SOVF_181430 [Spinacia oleracea]) HSP 1 Score: 132.1 bits (331), Expect = 4.2e-28 Identity = 71/79 (89.87%), Postives = 77/79 (97.47%), Query Frame = -3
BLAST of CU130250 vs. NCBI nr
Match: gi|297735830|emb|CBI18550.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 5.5e-28 Identity = 72/79 (91.14%), Postives = 76/79 (96.20%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|