CU129867 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTGCGTGGCCGATATGTTTGGGCGTGCGGGTCGTCTGGATGAAGCATTTGAAACCATAAATAGTATGCCATTCCCTCCAGATGCTGGTGTTTGGGGAACACTACTCGGGGCCTGCCACATTCATGGAAATGTTGAGCTTGCGGAAGTGGCATCAAAACATCTATTTGATTTAGACCCTTTGAACTCTGGGTACTATGTATTGCTTGCTAATGTGCAGGCTGGGGCTGG
BLAST of CU129867 vs. Swiss-Prot
Match: PP333_ARATH (Pentatricopeptide repeat-containing protein At4g21300 OS=Arabidopsis thaliana GN=PCMP-E36 PE=3 SV=1) HSP 1 Score: 125.2 bits (313), Expect = 3.1e-28 Identity = 57/75 (76.00%), Postives = 61/75 (81.33%), Query Frame = 3
BLAST of CU129867 vs. Swiss-Prot
Match: PP348_ARATH (Pentatricopeptide repeat-containing protein At4g33990 OS=Arabidopsis thaliana GN=EMB2758 PE=3 SV=2) HSP 1 Score: 95.9 bits (237), Expect = 2.0e-19 Identity = 40/75 (53.33%), Postives = 56/75 (74.67%), Query Frame = 3
HSP 2 Score: 36.6 bits (83), Expect = 1.4e-01 Identity = 21/56 (37.50%), Postives = 31/56 (55.36%), Query Frame = 3
BLAST of CU129867 vs. Swiss-Prot
Match: PP371_ARATH (Pentatricopeptide repeat-containing protein At5g08510 OS=Arabidopsis thaliana GN=PCMP-E20 PE=2 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 4.5e-19 Identity = 41/73 (56.16%), Postives = 53/73 (72.60%), Query Frame = 3
BLAST of CU129867 vs. Swiss-Prot
Match: PP223_ARATH (Putative pentatricopeptide repeat-containing protein At3g11460 OS=Arabidopsis thaliana GN=PCMP-H52 PE=3 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.9e-19 Identity = 41/71 (57.75%), Postives = 50/71 (70.42%), Query Frame = 3
BLAST of CU129867 vs. Swiss-Prot
Match: PP417_ARATH (Pentatricopeptide repeat-containing protein At5g44230 OS=Arabidopsis thaliana GN=PCMP-H17 PE=2 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.7e-18 Identity = 42/75 (56.00%), Postives = 51/75 (68.00%), Query Frame = 3
BLAST of CU129867 vs. TrEMBL
Match: A0A0A0LW16_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G553510 PE=4 SV=1) HSP 1 Score: 159.1 bits (401), Expect = 2.1e-36 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 3
BLAST of CU129867 vs. TrEMBL
Match: A0A067GD08_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g003150mg PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 60/75 (80.00%), Postives = 67/75 (89.33%), Query Frame = 3
BLAST of CU129867 vs. TrEMBL
Match: V4UIB9_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10014257mg PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 60/75 (80.00%), Postives = 67/75 (89.33%), Query Frame = 3
BLAST of CU129867 vs. TrEMBL
Match: A0A061G6X6_THECC (Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 2 OS=Theobroma cacao GN=TCM_026989 PE=4 SV=1) HSP 1 Score: 130.2 bits (326), Expect = 1.1e-27 Identity = 61/75 (81.33%), Postives = 66/75 (88.00%), Query Frame = 3
BLAST of CU129867 vs. TrEMBL
Match: A0A061G867_THECC (Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 OS=Theobroma cacao GN=TCM_026989 PE=4 SV=1) HSP 1 Score: 130.2 bits (326), Expect = 1.1e-27 Identity = 61/75 (81.33%), Postives = 66/75 (88.00%), Query Frame = 3
BLAST of CU129867 vs. NCBI nr
Match: gi|778662050|ref|XP_004135750.2| (PREDICTED: pentatricopeptide repeat-containing protein At4g21300-like [Cucumis sativus]) HSP 1 Score: 164.1 bits (414), Expect = 9.5e-38 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 3
BLAST of CU129867 vs. NCBI nr
Match: gi|659118448|ref|XP_008459124.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g21300 [Cucumis melo]) HSP 1 Score: 157.5 bits (397), Expect = 8.9e-36 Identity = 70/75 (93.33%), Postives = 75/75 (100.00%), Query Frame = 3
BLAST of CU129867 vs. NCBI nr
Match: gi|1009163141|ref|XP_015899806.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g21300 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 137.9 bits (346), Expect = 7.3e-30 Identity = 60/75 (80.00%), Postives = 68/75 (90.67%), Query Frame = 3
BLAST of CU129867 vs. NCBI nr
Match: gi|1009163145|ref|XP_015899808.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g21300 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 137.9 bits (346), Expect = 7.3e-30 Identity = 60/75 (80.00%), Postives = 68/75 (90.67%), Query Frame = 3
BLAST of CU129867 vs. NCBI nr
Match: gi|641858851|gb|KDO77573.1| (hypothetical protein CISIN_1g003150mg [Citrus sinensis]) HSP 1 Score: 137.5 bits (345), Expect = 9.6e-30 Identity = 60/75 (80.00%), Postives = 67/75 (89.33%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|