CU129865 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTGCCTTCGTATTTCCGTACCTTGAAGCCTGAGGCGATTGAAGCTAAGACCACCCATTGACCAATGAGCCTCGTTAGCCCATGAAAGGAGTGGATCGAGGACTGGAGTCGGTGGATCGACACGCTCATCATTGAACTTAACGTCGGAGTAGTAGCGAGGACGAGGGAGGCTGCTGCCGTAGAACTTTCCGGGGCCGAAGAGGGAAACCCACCCATGGGTGAGGATGGAACTGGACAGAGAATTTAGGGGTAAGGG
BLAST of CU129865 vs. TrEMBL
Match: A0A0A0K3S4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G048030 PE=4 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 6.0e-19 Identity = 47/59 (79.66%), Postives = 47/59 (79.66%), Query Frame = -1
BLAST of CU129865 vs. TrEMBL
Match: W9R4I2_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_004788 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.3e-16 Identity = 42/59 (71.19%), Postives = 45/59 (76.27%), Query Frame = -1
BLAST of CU129865 vs. TrEMBL
Match: S8DUT5_9LAMI (Uncharacterized protein OS=Genlisea aurea GN=M569_07871 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.8e-16 Identity = 42/63 (66.67%), Postives = 47/63 (74.60%), Query Frame = -1
BLAST of CU129865 vs. TrEMBL
Match: A0A0K9QWD7_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_138980 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.8e-16 Identity = 41/58 (70.69%), Postives = 45/58 (77.59%), Query Frame = -1
BLAST of CU129865 vs. TrEMBL
Match: A0A022QEF7_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a011791mg PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 8.1e-16 Identity = 42/63 (66.67%), Postives = 45/63 (71.43%), Query Frame = -1
BLAST of CU129865 vs. NCBI nr
Match: gi|449438098|ref|XP_004136827.1| (PREDICTED: uncharacterized protein LOC101207471 [Cucumis sativus]) HSP 1 Score: 101.3 bits (251), Expect = 8.6e-19 Identity = 47/59 (79.66%), Postives = 47/59 (79.66%), Query Frame = -1
BLAST of CU129865 vs. NCBI nr
Match: gi|659110606|ref|XP_008455314.1| (PREDICTED: uncharacterized protein LOC103495510 [Cucumis melo]) HSP 1 Score: 97.8 bits (242), Expect = 9.5e-18 Identity = 45/59 (76.27%), Postives = 46/59 (77.97%), Query Frame = -1
BLAST of CU129865 vs. NCBI nr
Match: gi|703073457|ref|XP_010089552.1| (hypothetical protein L484_004788 [Morus notabilis]) HSP 1 Score: 93.6 bits (231), Expect = 1.8e-16 Identity = 42/59 (71.19%), Postives = 45/59 (76.27%), Query Frame = -1
BLAST of CU129865 vs. NCBI nr
Match: gi|527198948|gb|EPS66908.1| (hypothetical protein M569_07871 [Genlisea aurea]) HSP 1 Score: 92.0 bits (227), Expect = 5.2e-16 Identity = 42/63 (66.67%), Postives = 47/63 (74.60%), Query Frame = -1
BLAST of CU129865 vs. NCBI nr
Match: gi|695063814|ref|XP_009420428.1| (PREDICTED: uncharacterized protein LOC104000171 [Musa acuminata subsp. malaccensis]) HSP 1 Score: 92.0 bits (227), Expect = 5.2e-16 Identity = 42/63 (66.67%), Postives = 46/63 (73.02%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|