CU129658 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTATTAATGGACTGTGTCAGATAGGCAATGCTACACAAGCTTGTGTACTGTTAGAAGAGATGATAGAGAAGGGAATTCGACCTTCTGGTGCCACATTCGGGAGGTTGAGACATTTTATTAATTAAGGAAGGCAGAAAAGATGTTCTAAAATTTCTGCAGGAGAAAATGAATTTACTAGTCAAGGAGCCATTATGTGATTGAGGAATCTTGGCTAAATGGAGCCATGCCACTTT
BLAST of CU129658 vs. Swiss-Prot
Match: PP129_ARATH (Pentatricopeptide repeat-containing protein At1g77360, mitochondrial OS=Arabidopsis thaliana GN=At1g77360 PE=2 SV=2) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-08 Identity = 27/39 (69.23%), Postives = 28/39 (71.79%), Query Frame = 3
HSP 2 Score: 49.3 bits (116), Expect = 2.2e-05 Identity = 23/28 (82.14%), Postives = 23/28 (82.14%), Query Frame = 1
BLAST of CU129658 vs. TrEMBL
Match: A0A0A0KH16_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G381820 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.7e-12 Identity = 37/39 (94.87%), Postives = 38/39 (97.44%), Query Frame = 3
BLAST of CU129658 vs. TrEMBL
Match: A0A0A0KH16_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G381820 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.1e-06 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 1
HSP 2 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of CU129658 vs. TrEMBL
Match: A0A067KM21_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12141 PE=4 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 2.5e-03 Identity = 23/28 (82.14%), Postives = 27/28 (96.43%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 6.7e-09 Identity = 31/39 (79.49%), Postives = 34/39 (87.18%), Query Frame = 3
BLAST of CU129658 vs. TrEMBL
Match: B9H7I8_POPTR (Pentatricopeptide repeat-containing family protein OS=Populus trichocarpa GN=POPTR_0005s20430g PE=4 SV=2) HSP 1 Score: 44.3 bits (103), Expect = 7.9e-02 Identity = 20/26 (76.92%), Postives = 25/26 (96.15%), Query Frame = 1
HSP 2 Score: 65.5 bits (158), Expect = 3.3e-08 Identity = 28/39 (71.79%), Postives = 34/39 (87.18%), Query Frame = 3
BLAST of CU129658 vs. TrEMBL
Match: B9S2U8_RICCO (Pentatricopeptide repeat-containing protein, putative OS=Ricinus communis GN=RCOM_0562410 PE=4 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 9.3e-03 Identity = 21/28 (75.00%), Postives = 27/28 (96.43%), Query Frame = 1
HSP 2 Score: 63.9 bits (154), Expect = 9.6e-08 Identity = 28/39 (71.79%), Postives = 33/39 (84.62%), Query Frame = 3
BLAST of CU129658 vs. NCBI nr
Match: gi|778715586|ref|XP_011657423.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g77360, mitochondrial [Cucumis sativus]) HSP 1 Score: 81.6 bits (200), Expect = 6.4e-13 Identity = 37/39 (94.87%), Postives = 38/39 (97.44%), Query Frame = 3
BLAST of CU129658 vs. NCBI nr
Match: gi|659133516|ref|XP_008466765.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g77360, mitochondrial [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 6.4e-13 Identity = 37/39 (94.87%), Postives = 38/39 (97.44%), Query Frame = 3
BLAST of CU129658 vs. NCBI nr
Match: gi|643723244|gb|KDP32849.1| (hypothetical protein JCGZ_12141 [Jatropha curcas]) HSP 1 Score: 71.2 bits (173), Expect = 8.6e-10 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of CU129658 vs. NCBI nr
Match: gi|802637190|ref|XP_012078305.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g77360, mitochondrial [Jatropha curcas]) HSP 1 Score: 71.2 bits (173), Expect = 8.6e-10 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of CU129658 vs. NCBI nr
Match: gi|566172349|ref|XP_002307458.2| (pentatricopeptide repeat-containing family protein [Populus trichocarpa]) HSP 1 Score: 69.7 bits (169), Expect = 2.5e-09 Identity = 31/39 (79.49%), Postives = 34/39 (87.18%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|