CU129569 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TATGGTGAGCTGGCGAAGAGGAAGACACTGGACTGGGCCACTAGACTTTCAATTGCACTTGGTGCTGCCAGAGGTTTGACGTATCTTCACACATTTGCTGGCAGATGTGTTATACATAGAGATGTAAAATCAAGCAATATACTTATGGACCATAGCATGTCTGCCAAGGTTGCAGTATTT
BLAST of CU129569 vs. Swiss-Prot
Match: NORK_PEA (Nodulation receptor kinase OS=Pisum sativum GN=NORK PE=1 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 2.2e-21 Identity = 51/60 (85.00%), Postives = 50/60 (83.33%), Query Frame = 1
BLAST of CU129569 vs. Swiss-Prot
Match: NORK_MEDTR (Nodulation receptor kinase OS=Medicago truncatula GN=NORK PE=1 SV=2) HSP 1 Score: 98.6 bits (244), Expect = 2.5e-20 Identity = 49/60 (81.67%), Postives = 49/60 (81.67%), Query Frame = 1
BLAST of CU129569 vs. Swiss-Prot
Match: Y1853_ARATH (Receptor-like serine/threonine-protein kinase At1g78530 OS=Arabidopsis thaliana GN=At1g78530 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.2e-12 Identity = 33/54 (61.11%), Postives = 41/54 (75.93%), Query Frame = 1
BLAST of CU129569 vs. Swiss-Prot
Match: Y5487_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At5g48740 OS=Arabidopsis thaliana GN=At5g48740 PE=2 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 9.4e-12 Identity = 33/60 (55.00%), Postives = 43/60 (71.67%), Query Frame = 1
BLAST of CU129569 vs. Swiss-Prot
Match: ERECT_ARATH (LRR receptor-like serine/threonine-protein kinase ERECTA OS=Arabidopsis thaliana GN=ERECTA PE=1 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.1e-11 Identity = 33/55 (60.00%), Postives = 38/55 (69.09%), Query Frame = 1
BLAST of CU129569 vs. TrEMBL
Match: A0A0A0KDC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G088150 PE=3 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.2e-24 Identity = 59/60 (98.33%), Postives = 59/60 (98.33%), Query Frame = 1
BLAST of CU129569 vs. TrEMBL
Match: B2G281_POPTR (Symbiosis receptor-like kinase OS=Populus trichocarpa GN=symrk PE=2 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 7.0e-22 Identity = 52/60 (86.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU129569 vs. TrEMBL
Match: U5GB09_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0007s14950g PE=3 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 7.0e-22 Identity = 52/60 (86.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU129569 vs. TrEMBL
Match: A0A067K7E8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12627 PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 3.5e-21 Identity = 52/60 (86.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU129569 vs. TrEMBL
Match: Q2TE70_ALNGL (Symbiosis receptor-like kinase OS=Alnus glutinosa GN=SYMRK PE=2 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 1.7e-20 Identity = 52/60 (86.67%), Postives = 54/60 (90.00%), Query Frame = 1
BLAST of CU129569 vs. NCBI nr
Match: gi|778722051|ref|XP_011658393.1| (PREDICTED: nodulation receptor kinase [Cucumis sativus]) HSP 1 Score: 119.8 bits (299), Expect = 1.7e-24 Identity = 59/60 (98.33%), Postives = 59/60 (98.33%), Query Frame = 1
BLAST of CU129569 vs. NCBI nr
Match: gi|659119973|ref|XP_008459943.1| (PREDICTED: nodulation receptor kinase-like [Cucumis melo]) HSP 1 Score: 113.6 bits (283), Expect = 1.2e-22 Identity = 56/60 (93.33%), Postives = 58/60 (96.67%), Query Frame = 1
BLAST of CU129569 vs. NCBI nr
Match: gi|359495806|ref|XP_002272055.2| (PREDICTED: nodulation receptor kinase-like [Vitis vinifera]) HSP 1 Score: 110.9 bits (276), Expect = 7.7e-22 Identity = 55/60 (91.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU129569 vs. NCBI nr
Match: gi|183579825|emb|CAO99188.1| (symbiosis receptor-like kinase [Populus trichocarpa]) HSP 1 Score: 110.5 bits (275), Expect = 1.0e-21 Identity = 52/60 (86.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU129569 vs. NCBI nr
Match: gi|566181400|ref|XP_006380830.1| (hypothetical protein POPTR_0007s14950g [Populus trichocarpa]) HSP 1 Score: 110.5 bits (275), Expect = 1.0e-21 Identity = 52/60 (86.67%), Postives = 56/60 (93.33%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|