CU129066 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGCAAATGCAGACTGCAAGCTGAAGATCTGTGACTTTGGACTTGCGCGTGCATCTTTCAGTGATGCCCCGTCTGCTATATTTTGGACTGATTATGTCGCTACTCGATGGTACCGTGCTCCTGAACTTTGTGGTTCTTTTTTCTCAAAGTATACACCAGCTATTGATATTTGGAGCATAGGATGTATATTTGCTGAAATGTTGGGAAGCAAGCCTTTGTT
BLAST of CU129066 vs. Swiss-Prot
Match: MPK9_ARATH (Mitogen-activated protein kinase 9 OS=Arabidopsis thaliana GN=MPK9 PE=2 SV=2) HSP 1 Score: 148.3 bits (373), Expect = 3.3e-35 Identity = 67/72 (93.06%), Postives = 67/72 (93.06%), Query Frame = 2
BLAST of CU129066 vs. Swiss-Prot
Match: MPK12_ORYSJ (Mitogen-activated protein kinase 12 OS=Oryza sativa subsp. japonica GN=MPK12 PE=1 SV=2) HSP 1 Score: 147.5 bits (371), Expect = 5.6e-35 Identity = 66/72 (91.67%), Postives = 68/72 (94.44%), Query Frame = 2
BLAST of CU129066 vs. Swiss-Prot
Match: MPK8_ARATH (Mitogen-activated protein kinase 8 OS=Arabidopsis thaliana GN=MPK8 PE=1 SV=2) HSP 1 Score: 147.1 bits (370), Expect = 7.3e-35 Identity = 66/72 (91.67%), Postives = 67/72 (93.06%), Query Frame = 2
BLAST of CU129066 vs. Swiss-Prot
Match: MPK15_ARATH (Mitogen-activated protein kinase 15 OS=Arabidopsis thaliana GN=MPK15 PE=1 SV=3) HSP 1 Score: 147.1 bits (370), Expect = 7.3e-35 Identity = 66/72 (91.67%), Postives = 67/72 (93.06%), Query Frame = 2
BLAST of CU129066 vs. Swiss-Prot
Match: MPK17_ORYSJ (Mitogen-activated protein kinase 17 OS=Oryza sativa subsp. japonica GN=MPK17 PE=2 SV=2) HSP 1 Score: 146.0 bits (367), Expect = 1.6e-34 Identity = 64/72 (88.89%), Postives = 66/72 (91.67%), Query Frame = 2
BLAST of CU129066 vs. TrEMBL
Match: A0A0A0KMF1_CUCSA (Mitogen-activated protein kinase OS=Cucumis sativus GN=Csa_5G002030 PE=4 SV=1) HSP 1 Score: 156.8 bits (395), Expect = 1.0e-35 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 2
BLAST of CU129066 vs. TrEMBL
Match: M0TWD2_MUSAM (Mitogen-activated protein kinase OS=Musa acuminata subsp. malaccensis PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.6e-34 Identity = 69/72 (95.83%), Postives = 70/72 (97.22%), Query Frame = 2
BLAST of CU129066 vs. TrEMBL
Match: A0A0A0R603_MUSAC (Mitogen-activated protein kinase OS=Musa acuminata AAA Group GN=MAPK3 PE=2 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.6e-34 Identity = 69/72 (95.83%), Postives = 70/72 (97.22%), Query Frame = 2
BLAST of CU129066 vs. TrEMBL
Match: A0A068TSP0_COFCA (Mitogen-activated protein kinase OS=Coffea canephora GN=GSCOC_T00022437001 PE=4 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 9.5e-34 Identity = 68/72 (94.44%), Postives = 69/72 (95.83%), Query Frame = 2
BLAST of CU129066 vs. TrEMBL
Match: A0A164SQ37_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_023595 PE=4 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 9.5e-34 Identity = 68/72 (94.44%), Postives = 69/72 (95.83%), Query Frame = 2
BLAST of CU129066 vs. NCBI nr
Match: gi|778697922|ref|XP_011654439.1| (PREDICTED: mitogen-activated protein kinase 17-like isoform X2 [Cucumis sativus]) HSP 1 Score: 158.3 bits (399), Expect = 5.0e-36 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 2
BLAST of CU129066 vs. NCBI nr
Match: gi|778697913|ref|XP_011654436.1| (PREDICTED: mitogen-activated protein kinase 9-like isoform X1 [Cucumis sativus]) HSP 1 Score: 158.3 bits (399), Expect = 5.0e-36 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 2
BLAST of CU129066 vs. NCBI nr
Match: gi|778697926|ref|XP_011654440.1| (PREDICTED: mitogen-activated protein kinase 12-like isoform X3 [Cucumis sativus]) HSP 1 Score: 158.3 bits (399), Expect = 5.0e-36 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 2
BLAST of CU129066 vs. NCBI nr
Match: gi|659109494|ref|XP_008454747.1| (PREDICTED: mitogen-activated protein kinase 17-like isoform X2 [Cucumis melo]) HSP 1 Score: 154.8 bits (390), Expect = 5.6e-35 Identity = 70/72 (97.22%), Postives = 71/72 (98.61%), Query Frame = 2
BLAST of CU129066 vs. NCBI nr
Match: gi|659109484|ref|XP_008454742.1| (PREDICTED: mitogen-activated protein kinase 9-like isoform X1 [Cucumis melo]) HSP 1 Score: 154.8 bits (390), Expect = 5.6e-35 Identity = 70/72 (97.22%), Postives = 71/72 (98.61%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|