CU128800 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCGGCCACGACCATCGACCTTACTGTGGCGGTCTTTAGAAGGGGGTTTTTTGACGGGTAAGGGGGTGGCGGCATTGTTGGAAGATTGATTCCCCTGTATTTGATGTCTGTGTTGTTGATGAGAAGGGTCAATTATGGCGCCATTGTTGTTGTTGACGCCGTCAGAAGCAGACATGGTTAAGAGAGAAGGGATGTTGGAGGAGGAGGAGGAGGAGGAGAATTGAAGGTGTAACAATGGAGGATTCCCCGGCCG
BLAST of CU128800 vs. TrEMBL
Match: A0A0A0KMY3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G352090 PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 9.4e-25 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -1
BLAST of CU128800 vs. TrEMBL
Match: A0A068U7Q1_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00018562001 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 8.0e-08 Identity = 34/56 (60.71%), Postives = 38/56 (67.86%), Query Frame = -1
BLAST of CU128800 vs. TrEMBL
Match: M4CZM0_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.4e-06 Identity = 30/55 (54.55%), Postives = 40/55 (72.73%), Query Frame = -1
BLAST of CU128800 vs. NCBI nr
Match: gi|449464308|ref|XP_004149871.1| (PREDICTED: transcription factor TCP21 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 3.3e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -1
BLAST of CU128800 vs. NCBI nr
Match: gi|659126302|ref|XP_008463113.1| (PREDICTED: transcription factor TCP21-like [Cucumis melo]) HSP 1 Score: 101.3 bits (251), Expect = 8.5e-19 Identity = 50/56 (89.29%), Postives = 50/56 (89.29%), Query Frame = -1
BLAST of CU128800 vs. NCBI nr
Match: gi|659126867|ref|XP_008463404.1| (PREDICTED: transcription factor TCP21-like [Cucumis melo]) HSP 1 Score: 94.7 bits (234), Expect = 8.0e-17 Identity = 48/57 (84.21%), Postives = 51/57 (89.47%), Query Frame = -1
BLAST of CU128800 vs. NCBI nr
Match: gi|661891660|emb|CDP04585.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 34/56 (60.71%), Postives = 38/56 (67.86%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|