CU128654 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCCACCTCTTGTTGTATTGACCACTTTGATCGTCTTCCTGATTCCCTTCTTCTTCTTATTTTCAACAAGATTGGTGACGTCAAGGCTCTTGGCCGATGCTGTGTTGTTTCTCGAAGGTTTCACTGCCTTGTGCCTCAAGTGGAAAACGTTGTTGTTCGCGTGGATTGTGTTATTTCTGATGATGAATCCTCTTCTTCTTCTTCTTCGTCTGGTAAATCTCGTGGCCCTTTTTTTAATATTTTTCGCTTTGTATTTGGTGG
BLAST of CU128654 vs. Swiss-Prot
Match: FB285_ARATH (F-box protein At5g46170 OS=Arabidopsis thaliana GN=At5g46170 PE=2 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.6e-26 Identity = 60/84 (71.43%), Postives = 62/84 (73.81%), Query Frame = 2
BLAST of CU128654 vs. Swiss-Prot
Match: FB237_ARATH (F-box protein At4g18380 OS=Arabidopsis thaliana GN=At4g18380 PE=2 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.6e-23 Identity = 56/83 (67.47%), Postives = 59/83 (71.08%), Query Frame = 2
BLAST of CU128654 vs. Swiss-Prot
Match: FB19_ARATH (F-box protein At1g30200 OS=Arabidopsis thaliana GN=At1g30200 PE=2 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.2e-20 Identity = 53/91 (58.24%), Postives = 58/91 (63.74%), Query Frame = 2
BLAST of CU128654 vs. Swiss-Prot
Match: FB303_ARATH (F-box protein At1g22220 OS=Arabidopsis thaliana GN=At1g22220 PE=2 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.1e-08 Identity = 28/55 (50.91%), Postives = 39/55 (70.91%), Query Frame = 2
BLAST of CU128654 vs. Swiss-Prot
Match: FB91_ARATH (F-box protein At1g78100 OS=Arabidopsis thaliana GN=At1g78100 PE=1 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 3.8e-06 Identity = 23/57 (40.35%), Postives = 38/57 (66.67%), Query Frame = 2
BLAST of CU128654 vs. TrEMBL
Match: A0A0A0LSD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025900 PE=4 SV=1) HSP 1 Score: 162.9 bits (411), Expect = 1.7e-37 Identity = 78/86 (90.70%), Postives = 78/86 (90.70%), Query Frame = 2
BLAST of CU128654 vs. TrEMBL
Match: I1MF15_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_15G092600 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 65/81 (80.25%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. TrEMBL
Match: A0A0S3S394_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.05G067500 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 65/81 (80.25%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. TrEMBL
Match: A0A0L9VFW1_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan09g222300 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 65/81 (80.25%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. TrEMBL
Match: I1M1H8_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G219800 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 65/81 (80.25%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. NCBI nr
Match: gi|449439183|ref|XP_004137366.1| (PREDICTED: F-box protein At5g46170-like [Cucumis sativus]) HSP 1 Score: 164.1 bits (414), Expect = 1.1e-37 Identity = 78/86 (90.70%), Postives = 78/86 (90.70%), Query Frame = 2
BLAST of CU128654 vs. NCBI nr
Match: gi|659068455|ref|XP_008444512.1| (PREDICTED: F-box protein At5g46170-like [Cucumis melo]) HSP 1 Score: 162.9 bits (411), Expect = 2.4e-37 Identity = 77/86 (89.53%), Postives = 78/86 (90.70%), Query Frame = 2
BLAST of CU128654 vs. NCBI nr
Match: gi|1012248389|ref|XP_015942888.1| (PREDICTED: F-box protein At5g46170 [Arachis duranensis]) HSP 1 Score: 137.9 bits (346), Expect = 8.4e-30 Identity = 66/81 (81.48%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. NCBI nr
Match: gi|147818878|emb|CAN73778.1| (hypothetical protein VITISV_042179 [Vitis vinifera]) HSP 1 Score: 136.7 bits (343), Expect = 1.9e-29 Identity = 66/81 (81.48%), Postives = 69/81 (85.19%), Query Frame = 2
BLAST of CU128654 vs. NCBI nr
Match: gi|225443916|ref|XP_002278480.1| (PREDICTED: F-box protein At5g46170 [Vitis vinifera]) HSP 1 Score: 136.7 bits (343), Expect = 1.9e-29 Identity = 66/81 (81.48%), Postives = 69/81 (85.19%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|