CU128346 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACATCAATTCATCATCGTCGTCGTCCACTCTTTTTAGTTCTGTCGATTCAGTTTTCAATTCAAAGACAGAGCTTCAAAAATCCCAACAATGGAACTTCAAATTCTGACCAAAGAAATCATCAAACCTTCTTCTCCAACCCCTTCTCATCTTCATCGTTTCAATATCTCTCTCCTCGACCAGCTCTCCACCGCCGGTTACGTCCCCGTCATTCTCTTTTTCCCCAATTCCAACGGAGCGCCGTCTTTTCACGAAAGAT
BLAST of CU128346 vs. Swiss-Prot
Match: SALAT_PAPSO (Salutaridinol 7-O-acetyltransferase OS=Papaver somniferum GN=SALAT PE=1 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.2e-07 Identity = 28/58 (48.28%), Postives = 39/58 (67.24%), Query Frame = 2
BLAST of CU128346 vs. TrEMBL
Match: A0A0A0LW24_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G044900 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.9e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU128346 vs. TrEMBL
Match: A0A124RHA1_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_026143 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.5e-09 Identity = 31/55 (56.36%), Postives = 41/55 (74.55%), Query Frame = 2
BLAST of CU128346 vs. TrEMBL
Match: A0A124RHA1_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_026143 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.4e-07 Identity = 28/49 (57.14%), Postives = 38/49 (77.55%), Query Frame = 2
HSP 2 Score: 69.7 bits (169), Expect = 2.0e-09 Identity = 30/50 (60.00%), Postives = 40/50 (80.00%), Query Frame = 2
BLAST of CU128346 vs. TrEMBL
Match: A0A103YEP0_CYNCS (Chloramphenicol acetyltransferase-like domain-containing protein OS=Cynara cardunculus var. scolymus GN=Ccrd_013923 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.3e-08 Identity = 28/49 (57.14%), Postives = 39/49 (79.59%), Query Frame = 2
BLAST of CU128346 vs. TrEMBL
Match: A0A103YEP0_CYNCS (Chloramphenicol acetyltransferase-like domain-containing protein OS=Cynara cardunculus var. scolymus GN=Ccrd_013923 PE=4 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.9e-07 Identity = 26/49 (53.06%), Postives = 38/49 (77.55%), Query Frame = 2
HSP 2 Score: 56.2 bits (134), Expect = 2.3e-05 Identity = 25/49 (51.02%), Postives = 35/49 (71.43%), Query Frame = 2
HSP 3 Score: 65.9 bits (159), Expect = 2.9e-08 Identity = 27/48 (56.25%), Postives = 39/48 (81.25%), Query Frame = 2
BLAST of CU128346 vs. NCBI nr
Match: gi|449469643|ref|XP_004152528.1| (PREDICTED: BAHD acyltransferase At5g47980-like [Cucumis sativus]) HSP 1 Score: 117.5 bits (293), Expect = 1.2e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU128346 vs. NCBI nr
Match: gi|659067044|ref|XP_008437382.1| (PREDICTED: BAHD acyltransferase At5g47980-like [Cucumis melo]) HSP 1 Score: 108.6 bits (270), Expect = 5.6e-21 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 2
BLAST of CU128346 vs. NCBI nr
Match: gi|976794200|gb|KVG85969.1| (hypothetical protein Ccrd_026143 [Cynara cardunculus var. scolymus]) HSP 1 Score: 70.9 bits (172), Expect = 1.3e-09 Identity = 31/55 (56.36%), Postives = 41/55 (74.55%), Query Frame = 2
BLAST of CU128346 vs. NCBI nr
Match: gi|976794199|gb|KVG85968.1| (Chloramphenicol acetyltransferase-like domain-containing protein [Cynara cardunculus var. scolymus]) HSP 1 Score: 70.5 bits (171), Expect = 1.7e-09 Identity = 30/50 (60.00%), Postives = 40/50 (80.00%), Query Frame = 2
BLAST of CU128346 vs. NCBI nr
Match: gi|976923379|gb|KVI07714.1| (Chloramphenicol acetyltransferase-like domain-containing protein [Cynara cardunculus var. scolymus]) HSP 1 Score: 67.8 bits (164), Expect = 1.1e-08 Identity = 28/49 (57.14%), Postives = 39/49 (79.59%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|