CU128246 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAATGTTTTTAGAGCTTGGACTAGTGCTCTTTCTTGTACAGCTGACCAATCGTCTTGCTCTGAACTAGAGGATACTCCATTTGCAGATGGATTGCTAGGAGTTTGGTTGTTTACATTTTGTCCTACCGAGGACATGTCCAGATTGCCATTAATTGCCACATTGTCTTCGGGTTTTTTAGAGGATACACCTTCTAACTCTTCTCTAGTTGAAAGCGGAGATGCAATGGACTGTGCCGGTTTCCTTT
BLAST of CU128246 vs. TrEMBL
Match: A0A0A0LAD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G223330 PE=4 SV=1) HSP 1 Score: 130.2 bits (326), Expect = 1.2e-27 Identity = 68/81 (83.95%), Postives = 68/81 (83.95%), Query Frame = -3
BLAST of CU128246 vs. TrEMBL
Match: A0A067LN92_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_11837 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.6e-11 Identity = 45/82 (54.88%), Postives = 53/82 (64.63%), Query Frame = -3
BLAST of CU128246 vs. TrEMBL
Match: A5C384_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_040643 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.9e-10 Identity = 44/82 (53.66%), Postives = 47/82 (57.32%), Query Frame = -3
BLAST of CU128246 vs. TrEMBL
Match: F6HF72_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_01s0011g00790 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.9e-10 Identity = 44/82 (53.66%), Postives = 47/82 (57.32%), Query Frame = -3
BLAST of CU128246 vs. TrEMBL
Match: B9SS17_RICCO (Zuotin, putative OS=Ricinus communis GN=RCOM_0519910 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.8e-09 Identity = 41/82 (50.00%), Postives = 52/82 (63.41%), Query Frame = -3
BLAST of CU128246 vs. NCBI nr
Match: gi|659112064|ref|XP_008456047.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Cucumis melo]) HSP 1 Score: 127.1 bits (318), Expect = 1.4e-26 Identity = 68/81 (83.95%), Postives = 68/81 (83.95%), Query Frame = -3
BLAST of CU128246 vs. NCBI nr
Match: gi|449457039|ref|XP_004146256.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Cucumis sativus]) HSP 1 Score: 127.1 bits (318), Expect = 1.4e-26 Identity = 68/81 (83.95%), Postives = 68/81 (83.95%), Query Frame = -3
BLAST of CU128246 vs. NCBI nr
Match: gi|802540159|ref|XP_012075001.1| (PREDICTED: dnaJ homolog subfamily C member 2 [Jatropha curcas]) HSP 1 Score: 72.8 bits (177), Expect = 3.1e-10 Identity = 45/82 (54.88%), Postives = 53/82 (64.63%), Query Frame = -3
BLAST of CU128246 vs. NCBI nr
Match: gi|731371865|ref|XP_010649490.1| (PREDICTED: dnaJ homolog subfamily C member 2 [Vitis vinifera]) HSP 1 Score: 68.6 bits (166), Expect = 5.9e-09 Identity = 44/82 (53.66%), Postives = 47/82 (57.32%), Query Frame = -3
BLAST of CU128246 vs. NCBI nr
Match: gi|147802497|emb|CAN64160.1| (hypothetical protein VITISV_040643 [Vitis vinifera]) HSP 1 Score: 68.6 bits (166), Expect = 5.9e-09 Identity = 44/82 (53.66%), Postives = 47/82 (57.32%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|