CU127802 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGTGATGAATTGTGCAATAGCTTAAGGTGAGATCGGTTAGAGATGGACAATGGTTGGAGAGAATGAAAAGTCCACGATCATCCAATTGCTTCCCTAGTTTTGACATCCAACCTGAATACGTGATCTCAATTCGTACTAAATTGGGAAACCTAAGACACAGAGATGTCAAAGCTTCATCTGCAGGGTCTAATCCACAACCAACTCGAAGGAACTGTCTGTTTTCTTTATCTAAACG
BLAST of CU127802 vs. Swiss-Prot
Match: FBL14_ARATH (F-box/LRR-repeat protein 14 OS=Arabidopsis thaliana GN=FBL14 PE=2 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.1e-24 Identity = 51/74 (68.92%), Postives = 59/74 (79.73%), Query Frame = -1
BLAST of CU127802 vs. TrEMBL
Match: A0A0A0K8N4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G432150 PE=4 SV=1) HSP 1 Score: 158.7 bits (400), Expect = 2.9e-36 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = -1
BLAST of CU127802 vs. TrEMBL
Match: B9IJF9_POPTR (F-box family protein OS=Populus trichocarpa GN=POPTR_0017s08050g PE=4 SV=1) HSP 1 Score: 130.6 bits (327), Expect = 8.5e-28 Identity = 59/74 (79.73%), Postives = 68/74 (91.89%), Query Frame = -1
BLAST of CU127802 vs. TrEMBL
Match: W9QX54_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_009485 PE=4 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 4.2e-27 Identity = 59/74 (79.73%), Postives = 65/74 (87.84%), Query Frame = -1
BLAST of CU127802 vs. TrEMBL
Match: A0A059AJE5_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J03091 PE=4 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 5.5e-27 Identity = 57/74 (77.03%), Postives = 67/74 (90.54%), Query Frame = -1
BLAST of CU127802 vs. TrEMBL
Match: B9SWS9_RICCO (Ubiquitin-protein ligase, putative OS=Ricinus communis GN=RCOM_0010960 PE=4 SV=1) HSP 1 Score: 127.5 bits (319), Expect = 7.2e-27 Identity = 58/74 (78.38%), Postives = 67/74 (90.54%), Query Frame = -1
BLAST of CU127802 vs. NCBI nr
Match: gi|778728972|ref|XP_011659509.1| (PREDICTED: F-box/LRR-repeat protein 14 isoform X1 [Cucumis sativus]) HSP 1 Score: 162.2 bits (409), Expect = 3.8e-37 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = -1
BLAST of CU127802 vs. NCBI nr
Match: gi|778728975|ref|XP_011659510.1| (PREDICTED: F-box/LRR-repeat protein 14 isoform X2 [Cucumis sativus]) HSP 1 Score: 162.2 bits (409), Expect = 3.8e-37 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = -1
BLAST of CU127802 vs. NCBI nr
Match: gi|659122469|ref|XP_008461161.1| (PREDICTED: F-box/LRR-repeat protein 14 isoform X2 [Cucumis melo]) HSP 1 Score: 160.2 bits (404), Expect = 1.4e-36 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU127802 vs. NCBI nr
Match: gi|659122467|ref|XP_008461160.1| (PREDICTED: F-box/LRR-repeat protein 14 isoform X1 [Cucumis melo]) HSP 1 Score: 160.2 bits (404), Expect = 1.4e-36 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU127802 vs. NCBI nr
Match: gi|659122471|ref|XP_008461162.1| (PREDICTED: F-box/LRR-repeat protein 14 isoform X3 [Cucumis melo]) HSP 1 Score: 160.2 bits (404), Expect = 1.4e-36 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|