CU127766 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGGATATAGTTCGTGCGTCTAGTCGAGGTTTAAAAATGGTTGTTGTTTTTGCCGGTTCCACGAGTCTGTGTTTGCCGGGAAATGCTTTAGCGGCGGCATGCGTGCGGAGAAGACGAAGCCAGGGAATTACTATAAGAAGCGAGGCAGAAGGGAAAAATCCGATTCCAGGTAGAGACCGGGTGATAGGGTTTGGAAAACACAAGGGCAAAATGCTTGGAACCCTTCCTTCAACCTATCTGAAATGGATCTCCAAAAACCTTCGAGCAAGAGAGTTCG
BLAST of CU127766 vs. TrEMBL
Match: A0A0A0K7H6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G447750 PE=4 SV=1) HSP 1 Score: 183.0 bits (463), Expect = 1.7e-43 Identity = 90/91 (98.90%), Postives = 91/91 (100.00%), Query Frame = 2
BLAST of CU127766 vs. TrEMBL
Match: A0A059AJ13_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J03180 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 5.1e-11 Identity = 36/61 (59.02%), Postives = 44/61 (72.13%), Query Frame = 2
BLAST of CU127766 vs. TrEMBL
Match: A0A068TT13_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00026614001 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 4.3e-10 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = 2
BLAST of CU127766 vs. TrEMBL
Match: A0A0V0HB17_SOLCH (Putative ovule protein (Fragment) OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.3e-09 Identity = 31/38 (81.58%), Postives = 35/38 (92.11%), Query Frame = 2
BLAST of CU127766 vs. TrEMBL
Match: M1BK02_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400018255 PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.3e-09 Identity = 31/38 (81.58%), Postives = 35/38 (92.11%), Query Frame = 2
BLAST of CU127766 vs. NCBI nr
Match: gi|700190180|gb|KGN45413.1| (hypothetical protein Csa_7G447750 [Cucumis sativus]) HSP 1 Score: 182.6 bits (462), Expect = 3.3e-43 Identity = 90/91 (98.90%), Postives = 91/91 (100.00%), Query Frame = 2
BLAST of CU127766 vs. NCBI nr
Match: gi|778729445|ref|XP_004141831.2| (PREDICTED: uncharacterized protein LOC101215921 [Cucumis sativus]) HSP 1 Score: 162.9 bits (411), Expect = 2.7e-37 Identity = 79/80 (98.75%), Postives = 80/80 (100.00%), Query Frame = 2
BLAST of CU127766 vs. NCBI nr
Match: gi|659124514|ref|XP_008462203.1| (PREDICTED: uncharacterized protein LOC103500617 [Cucumis melo]) HSP 1 Score: 149.4 bits (376), Expect = 3.1e-33 Identity = 74/80 (92.50%), Postives = 76/80 (95.00%), Query Frame = 2
BLAST of CU127766 vs. NCBI nr
Match: gi|470140146|ref|XP_004305804.1| (PREDICTED: uncharacterized protein LOC101304796 [Fragaria vesca subsp. vesca]) HSP 1 Score: 77.8 bits (190), Expect = 1.1e-11 Identity = 34/39 (87.18%), Postives = 36/39 (92.31%), Query Frame = 2
BLAST of CU127766 vs. NCBI nr
Match: gi|697154817|ref|XP_009631645.1| (PREDICTED: uncharacterized protein LOC104121375 [Nicotiana tomentosiformis]) HSP 1 Score: 77.4 bits (189), Expect = 1.5e-11 Identity = 39/67 (58.21%), Postives = 47/67 (70.15%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|