CU127306 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAACACACAACAAATAAAGAATGGCAACCTTAGAAAACAAGCTTCAAGAAGCAGCAATGTCAGGCAACCTAGAAAAGATAATAGAACTGCTTCAACAATCCCTTCGTCTTATCGATACAGTCGGACCCGATAATCCACCGCCTCACGATTTCGCCAATTTCCCTGACCGGATTCTTCAACAGAAGCCTCACCTGACTCGAGTGTTGGACTCAAAGGGATCATGCCCCCTTCACTTAGCAG
BLAST of CU127306 vs. TrEMBL
Match: A0A0A0KFJ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G363550 PE=4 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 8.3e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 3
BLAST of CU127306 vs. NCBI nr
Match: gi|449453051|ref|XP_004144272.1| (PREDICTED: ankyrin repeat-containing protein At3g12360-like [Cucumis sativus]) HSP 1 Score: 152.1 bits (383), Expect = 4.1e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 3
BLAST of CU127306 vs. NCBI nr
Match: gi|659089461|ref|XP_008445520.1| (PREDICTED: ankyrin repeat-containing protein At3g12360-like [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 8.0e-30 Identity = 65/73 (89.04%), Postives = 70/73 (95.89%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|