CU126497 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTGAGTCACAGGCATTGAAATATTCCAGAGCACTTGCAGTGTATGAACAAGAAAAAGTTCCTGCCCATGATCCAACAATGGAAGATTTTTTTTCAAAAACTTTTCCATTTTCTAGCCAATATTACAGAAAAAAGGCAATGAAGCC
BLAST of CU126497 vs. TrEMBL
Match: A0A0A0KXA6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G011100 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 7.6e-19 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU126497 vs. TrEMBL
Match: A0A067F9A8_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g012161mg PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 5.6e-06 Identity = 29/49 (59.18%), Postives = 38/49 (77.55%), Query Frame = 1
BLAST of CU126497 vs. TrEMBL
Match: V4TWA5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10019728mg PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 5.6e-06 Identity = 29/49 (59.18%), Postives = 38/49 (77.55%), Query Frame = 1
BLAST of CU126497 vs. NCBI nr
Match: gi|449469202|ref|XP_004152310.1| (PREDICTED: uncharacterized protein LOC101221808 [Cucumis sativus]) HSP 1 Score: 98.6 bits (244), Expect = 3.2e-18 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU126497 vs. NCBI nr
Match: gi|659108194|ref|XP_008454067.1| (PREDICTED: uncharacterized protein LOC103494594 isoform X1 [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 2.0e-17 Identity = 46/48 (95.83%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU126497 vs. NCBI nr
Match: gi|659108196|ref|XP_008454068.1| (PREDICTED: uncharacterized protein LOC103494594 isoform X2 [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 2.0e-17 Identity = 46/48 (95.83%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU126497 vs. NCBI nr
Match: gi|659108198|ref|XP_008454069.1| (PREDICTED: uncharacterized protein LOC103494594 isoform X3 [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 2.0e-17 Identity = 46/48 (95.83%), Postives = 48/48 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|