CU126335 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGGGAGGATTGGTCAGGGAGAAACTCTGGGACTTGCTGGTTAATGAGCCTGATGTTATAATGGAAGAAGGGTTCCCAAATGCCACAGGTAAGGAGCAATCTATCAAAGGAATGAGATCATCAGAGTTTTGCTTACACCCAGCTGGGGATACCCCTACATCGTGCCGCCTTTTCGACGCCATCCAAAGTCTCTGTATACCTGTGGTTGTGAGCGACAACATCGAGCTTCCATTTGAAGCATGG
BLAST of CU126335 vs. Swiss-Prot
Match: ARAD1_ARATH (Probable arabinosyltransferase ARAD1 OS=Arabidopsis thaliana GN=ARAD1 PE=1 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 4.8e-19 Identity = 42/78 (53.85%), Postives = 58/78 (74.36%), Query Frame = 1
BLAST of CU126335 vs. Swiss-Prot
Match: ARAD2_ARATH (Probable arabinosyltransferase ARAD2 OS=Arabidopsis thaliana GN=ARAD2 PE=1 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 9.1e-18 Identity = 43/78 (55.13%), Postives = 54/78 (69.23%), Query Frame = 1
BLAST of CU126335 vs. TrEMBL
Match: A0A0A0K3Q7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G201900 PE=4 SV=1) HSP 1 Score: 165.6 bits (418), Expect = 2.5e-38 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. TrEMBL
Match: M5VMT1_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa004914mg PE=4 SV=1) HSP 1 Score: 161.4 bits (407), Expect = 4.7e-37 Identity = 75/79 (94.94%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. TrEMBL
Match: A0A0D2RH29_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G075900 PE=4 SV=1) HSP 1 Score: 161.0 bits (406), Expect = 6.1e-37 Identity = 75/79 (94.94%), Postives = 78/79 (98.73%), Query Frame = 1
BLAST of CU126335 vs. TrEMBL
Match: A0A0B0NS70_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_16979 PE=4 SV=1) HSP 1 Score: 161.0 bits (406), Expect = 6.1e-37 Identity = 75/79 (94.94%), Postives = 78/79 (98.73%), Query Frame = 1
BLAST of CU126335 vs. TrEMBL
Match: A0A103XJV0_CYNCS (Exostosin-like protein OS=Cynara cardunculus var. scolymus GN=Ccrd_005951 PE=4 SV=1) HSP 1 Score: 160.6 bits (405), Expect = 7.9e-37 Identity = 74/79 (93.67%), Postives = 78/79 (98.73%), Query Frame = 1
BLAST of CU126335 vs. NCBI nr
Match: gi|778725585|ref|XP_004139861.2| (PREDICTED: probable arabinosyltransferase ARAD2 [Cucumis sativus]) HSP 1 Score: 169.1 bits (427), Expect = 3.2e-39 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. NCBI nr
Match: gi|659093871|ref|XP_008447763.1| (PREDICTED: probable arabinosyltransferase ARAD2 [Cucumis melo]) HSP 1 Score: 168.7 bits (426), Expect = 4.2e-39 Identity = 78/79 (98.73%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. NCBI nr
Match: gi|694423906|ref|XP_009339741.1| (PREDICTED: probable arabinosyltransferase ARAD1 [Pyrus x bretschneideri]) HSP 1 Score: 165.6 bits (418), Expect = 3.5e-38 Identity = 75/79 (94.94%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. NCBI nr
Match: gi|694422485|ref|XP_009339071.1| (PREDICTED: probable arabinosyltransferase ARAD1 [Pyrus x bretschneideri]) HSP 1 Score: 165.6 bits (418), Expect = 3.5e-38 Identity = 75/79 (94.94%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of CU126335 vs. NCBI nr
Match: gi|595795265|ref|XP_007200987.1| (hypothetical protein PRUPE_ppa004914mg [Prunus persica]) HSP 1 Score: 164.9 bits (416), Expect = 6.0e-38 Identity = 75/79 (94.94%), Postives = 79/79 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|