CU126310 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGATTTTGGCTTCTCCAAGCAAACATGTACTAAATATATGTCGATGCTGAACATTATCCTTTCAGATGGAAGTACAAGTACAACGTCGAAATTATTAAAGCGAACTATATGTAAGAAAGATCAATTGATACTAGACAATGTCAATACACTTTCAGTTTCAGATGGAAGTCGAACGTCAACACCAGAGTTGAAGTT
BLAST of CU126310 vs. TrEMBL
Match: A0A0A0L3P0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G454150 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 7.0e-20 Identity = 58/83 (69.88%), Postives = 58/83 (69.88%), Query Frame = 3
BLAST of CU126310 vs. NCBI nr
Match: gi|778694842|ref|XP_011653877.1| (PREDICTED: serine/threonine-protein kinase SRK2G-like isoform X1 [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 1.0e-19 Identity = 58/83 (69.88%), Postives = 58/83 (69.88%), Query Frame = 3
BLAST of CU126310 vs. NCBI nr
Match: gi|700199598|gb|KGN54756.1| (hypothetical protein Csa_4G454150 [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 1.0e-19 Identity = 58/83 (69.88%), Postives = 58/83 (69.88%), Query Frame = 3
BLAST of CU126310 vs. NCBI nr
Match: gi|778694846|ref|XP_011653878.1| (PREDICTED: CBL-interacting serine/threonine-protein kinase 17-like isoform X2 [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 1.0e-19 Identity = 58/83 (69.88%), Postives = 58/83 (69.88%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|