CU126232 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGTTGATCTATCTCGGTATTTAGATTTGATGAATGCATGTGGGGAAGCAAGGTCCCTAGAAGAAGCCAAAGTTGTTTGTAATTACGTAATTAAATCTCAAACCCATGTAAAAGTTAGCACCTATAACAAAATTTTGGAGATGTACTCTAAATGTGGTTCCATGGATGATGCATATACGATATTCAATAAAATGCCTAGCCGCAACATAACATCTTGGGATACT
BLAST of CU126232 vs. Swiss-Prot
Match: PP346_ARATH (Pentatricopeptide repeat-containing protein At4g32450, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H63 PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.3e-14 Identity = 35/72 (48.61%), Postives = 47/72 (65.28%), Query Frame = 3
BLAST of CU126232 vs. Swiss-Prot
Match: PP170_ARATH (Pentatricopeptide repeat-containing protein At2g25580 OS=Arabidopsis thaliana GN=PCMP-H75 PE=2 SV=2) HSP 1 Score: 68.9 bits (167), Expect = 2.6e-11 Identity = 32/72 (44.44%), Postives = 45/72 (62.50%), Query Frame = 3
BLAST of CU126232 vs. Swiss-Prot
Match: PP183_ARATH (Pentatricopeptide repeat-containing protein At2g34370, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H25 PE=2 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.8e-11 Identity = 33/74 (44.59%), Postives = 43/74 (58.11%), Query Frame = 3
BLAST of CU126232 vs. Swiss-Prot
Match: PP353_ARATH (Pentatricopeptide repeat-containing protein At4g37170 OS=Arabidopsis thaliana GN=PCMP-H5 PE=3 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.4e-09 Identity = 27/70 (38.57%), Postives = 44/70 (62.86%), Query Frame = 3
BLAST of CU126232 vs. Swiss-Prot
Match: PP175_ARATH (Pentatricopeptide repeat-containing protein At2g29760, chloroplastic OS=Arabidopsis thaliana GN=PCMP-H33 PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.2e-08 Identity = 23/66 (34.85%), Postives = 45/66 (68.18%), Query Frame = 3
BLAST of CU126232 vs. TrEMBL
Match: A0A0A0M061_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G659600 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 5.2e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU126232 vs. TrEMBL
Match: A5AQE7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_020760 PE=4 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.3e-22 Identity = 53/74 (71.62%), Postives = 62/74 (83.78%), Query Frame = 3
BLAST of CU126232 vs. TrEMBL
Match: F6H3U1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_04s0008g05070 PE=4 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.3e-22 Identity = 53/74 (71.62%), Postives = 62/74 (83.78%), Query Frame = 3
BLAST of CU126232 vs. TrEMBL
Match: W9RUL3_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_015521 PE=4 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 5.1e-22 Identity = 49/73 (67.12%), Postives = 64/73 (87.67%), Query Frame = 3
BLAST of CU126232 vs. TrEMBL
Match: A0A103XFB3_CYNCS (Pentatricopeptide repeat-containing protein OS=Cynara cardunculus var. scolymus GN=Ccrd_008392 PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 3.6e-20 Identity = 48/74 (64.86%), Postives = 61/74 (82.43%), Query Frame = 3
BLAST of CU126232 vs. NCBI nr
Match: gi|778664160|ref|XP_011660234.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 7.5e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU126232 vs. NCBI nr
Match: gi|659086007|ref|XP_008443720.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial-like [Cucumis melo]) HSP 1 Score: 152.9 bits (385), Expect = 2.2e-34 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU126232 vs. NCBI nr
Match: gi|147856667|emb|CAN80315.1| (hypothetical protein VITISV_020760 [Vitis vinifera]) HSP 1 Score: 113.2 bits (282), Expect = 1.9e-22 Identity = 53/74 (71.62%), Postives = 62/74 (83.78%), Query Frame = 3
BLAST of CU126232 vs. NCBI nr
Match: gi|296082000|emb|CBI21005.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 113.2 bits (282), Expect = 1.9e-22 Identity = 53/74 (71.62%), Postives = 62/74 (83.78%), Query Frame = 3
BLAST of CU126232 vs. NCBI nr
Match: gi|225430210|ref|XP_002282464.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial [Vitis vinifera]) HSP 1 Score: 113.2 bits (282), Expect = 1.9e-22 Identity = 53/74 (71.62%), Postives = 62/74 (83.78%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|