CU126192 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCCCGGCCGAAAGGGAGGAGTTCAACGACTTCCATTTCGAATTCTTCTTCGGTGGAATTGGTTAATGGAGATAAACCCAAAAGTCCAATGGAGTAATTGGGAATTCGATTATTAATGCCCTCAAGGCGTTGCAGAAACCTGCAATTGCTGCGGTGTTGTTGGGATTGCTGTTGATGGACGATCCCAATTCTGCGTTGGCCGCTTC
BLAST of CU126192 vs. TrEMBL
Match: A0A0A0M3K0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G695410 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 7.6e-09 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU126192 vs. TrEMBL
Match: A0A0A0M3K0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G695410 PE=4 SV=1) HSP 1 Score: 36.2 bits (82), Expect = 1.9e+01 Identity = 18/31 (58.06%), Postives = 19/31 (61.29%), Query Frame = 1
HSP 2 Score: 57.4 bits (137), Expect = 7.8e-06 Identity = 28/37 (75.68%), Postives = 34/37 (91.89%), Query Frame = 3
BLAST of CU126192 vs. NCBI nr
Match: gi|449449537|ref|XP_004142521.1| (PREDICTED: uncharacterized protein LOC101210275 [Cucumis sativus]) HSP 1 Score: 65.9 bits (159), Expect = 3.2e-08 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU126192 vs. NCBI nr
Match: gi|700211710|gb|KGN66806.1| (hypothetical protein Csa_1G695410 [Cucumis sativus]) HSP 1 Score: 65.9 bits (159), Expect = 3.2e-08 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU126192 vs. NCBI nr
Match: gi|659131254|ref|XP_008465590.1| (PREDICTED: uncharacterized protein LOC103503226 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 2.7e-07 Identity = 34/37 (91.89%), Postives = 35/37 (94.59%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|