CU126158 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTAATAAGAAATTATGAAATTAGACTAAACGGGCATATGAGAGAGAAAATGGAAAAGGCTAAAAGGGTAAATGGTGGCGGTGAACCGGAGAGTGAGGGGACGAGGTGGACATGACGGCGAAACGAGAGCTGTAAATGGTGGAAACATCGACGCTGGTGGTGGTGGGTGCCCATGGGCTCTGACTTGGCGAGGTCATGCTTATGGAATTGGTTACGCCACCGCCGTACCCT
BLAST of CU126158 vs. TrEMBL
Match: A0A0A0LPU0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G026000 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.7e-23 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -2
BLAST of CU126158 vs. NCBI nr
Match: gi|778656616|ref|XP_011649394.1| (PREDICTED: extra-large guanine nucleotide-binding protein 3-like [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 8.2e-21 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -2
BLAST of CU126158 vs. NCBI nr
Match: gi|700208824|gb|KGN63920.1| (hypothetical protein Csa_1G026000 [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 8.2e-21 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -2
BLAST of CU126158 vs. NCBI nr
Match: gi|659114912|ref|XP_008457288.1| (PREDICTED: uncharacterized protein LOC103497015 [Cucumis melo]) HSP 1 Score: 103.2 bits (256), Expect = 2.0e-19 Identity = 51/54 (94.44%), Postives = 53/54 (98.15%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|